Argyroploce chlorosaris

Meyrick, 1914 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Argyroploce

At a glance

Occurrence records37

Data sources7

Biological traits0

DNA specimens3

eDNA detections3

Sources7 archives

Databases and archives Argyroploce chlorosaris's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility37 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF37 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD3 specimens

01Narrative

Argyroploce chlorosaris is a species of moth in the family Tortricidae first described by Edward Meyrick in 1914. This species is endemic to New Zealand. The classification of this moth within the genus Argyroploce is regarded as unsatisfactory and in need of revision. As such this species is currently also known as Argyroploce (s.l.) chlorosaris.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyroploce chlorosaris has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

eDNA detections3

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P636 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

157Cvariable

379Cvariable

389Gvariable

433Gvariable

AACATTATATTTTATCTTCGGTATTTGAGCCGGTATAGTAGGAACTTCTCTTAGATTATTAATTCGAGCTGAGTTAGGAAATCCCGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.42%

Haplotypes3

BIN1

Most divergent pair0.47%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Dactylioglypha tonicasame family9.1%Holocola pericyphanasame family9.4%Pelochrista morrisonisame family9.4%Psychocampa prominenssame order9.7%Eudemis porphyranasame family9.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type37 records

Wild obs. + sensor33

Museum / vouchered4

Range

Area of Occupancy AOO76 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 18≤1 km 1>10 km 2

21 georeferenced · 12 without coordinates

Open the mapobservation + sensor33

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 3 without coordinates

Open the institutions mapphysical evidence4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
MWLRlocation not on record	3
New Zealand Arthropod Collectionlocation not on record	1

2 institutions · 4 of 4 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Argyroploce chlorosaris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.4 °C 15.7–18.1

Seasonal swing summer↔winter7.60 °C

Max temp (day)18.2 °C 16.8–20.4

Min temp (night)14.7 °C 14.5–15.9

Precipitation138 mm/mo 102–147

Air humidity65.7 % 61.5–67.1

Moisture balance5.70 mm/mo

Vapour deficit636 Pa 584–800

Wind speed4.30 m/s

Cloud cover37.2 % 36.4–37.2

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)