Argyrocottus zanderi

Herzenstein, 1892 · species

image placeholder — illustration coming later

Animalia/Chordata/Scorpaeniformes/Cottidae/Argyrocottus

At a glance

Occurrence records50

Data sources8

Biological traits6

DNA specimens14

eDNA detections127

Sources8 archives

Databases and archives Argyrocottus zanderi's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility19 records↗

OBISOcean Biodiversity Information System31 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI127 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS50 records

Environmental DNA2 datasets · 2 countries127 detections

DNA & barcodingBOLD14 specimens

01Narrative

Argyrocottus zanderi is a species of sculpin native to the northwestern Pacific Ocean from Japan to the Kuril Islands and in the Sea of Japan. It is found at depths of from 0 to. This species grows to a length of 9 cm SL. This species is the only known member of its genus.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length9 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

Other traits3

Depth max85 m

Depth min0 m

Vulnerability10

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyrocottus zanderi has left across the world's sequence archives.

At a glance

DNA specimens14

BINs1

Marker genes1

eDNA detections127

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P600 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

144Cvariable

228Tvariable

234Tmostly conserved

267Gmostly conserved

438Gvariable

477Cmostly conserved

498Cmostly conserved

CTTCTAATCCGAGCAGAACTAAGCCAACCCGGCGCCCTTTTGGGGGATGACCAGATTTATAATGTAATTGTTACAGCTCATGCCTTCGTA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.35%

Haplotypes5

BIN1

Most divergent pair0.83%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Myoxocephalus jaoksame family9.3%Myoxocephalus scorpioidessame family9.5%Myoxocephalus quadricornissame family9.8%Myoxocephalus thompsoniisame family10.0%Myoxocephalus stellerisame family10.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_057483 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTB12S ribosomal RNA16S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type50 records

Museum / vouchered50

Origin

Native2

Range

Area of Occupancy AOO60 km²

Depth

0–200 m sunlit15

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 2.5 m · max 28 m · 15 records with depth

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 5

5 georeferenced · 45 without coordinates

Open the institutions mapphysical evidence50

10Collections & institutions

Holding institutions1 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Mazandaranlocation not on record	6
UWFClocation not on record	2
Cambridge, US	1
CASlocation not on record	1
Kagoshima University Museumlocation not on record	1

5 institutions · 11 of 50 vouchered records shown · 8 without an institution code

09Environmental DNA127 detections

Where the DNA of Argyrocottus zanderi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found127

Studies independent surveys2

Countries2

Verifiable raw sequence linked113

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 127 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.3 °C -2.80–19.1

Seasonal swing summer↔winter25.9 °C

Max temp (day)13.3 °C 0.9–23.2

Min temp (night)7.80 °C -6.10–16.4

Precipitation107 mm/mo 89.3–130

Air humidity61.5 % 58.7–65.7

Moisture balance14.0 mm/mo -48.3–90.7

Vapour deficit494 Pa 197–824

Wind speed4.60 m/s 3.90–5.70

Cloud cover51.7 % 45.7–63.5

CHELSA 1981–2010, ~9 km grid, at location & month of 116 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)