Argyria lacteella

Fabricius, 1794 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Argyria

At a glance

Occurrence records486

Data sources7

Biological traits0

DNA specimens52

eDNA detections39

Sources7 archives

Databases and archives Argyria lacteella's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility486 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI39 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics52 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF486 records

Environmental DNA1 datasets · 3 countries39 detections

DNA & barcodingBOLD52 specimens

01Narrative

Argyria lacteella, the milky urola moth, is a moth in the family Crambidae. It was described by Johan Christian Fabricius in 1794. It is found in North America, from Maryland south to Florida and west to Texas. In the south, the range extends through Costa Rica to Brazil. It is also found on Cuba, Puerto Rico and Bermuda. The wingspan is about 16 mm. The forewings are white with a small dark spot at the costa and at the inner margin, as well as a dark spot halfway between these two. The hindwings are uniform white. Adults are on wing from spring to fall.Bug Guide

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding52 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyria lacteella has left across the world's sequence archives.

At a glance

DNA specimens52

BINs5

Marker genes1

eDNA detections39

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus49 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 86% of positions are identical in every specimen.

Where individuals differ — all 90 variable positions, in barcode order

31Tmostly conserved

34Amostly conserved

40Gvariable

49Tmostly conserved

55Tmostly conserved

76Gvariable

79Amostly conserved

82Tmostly conserved

85Amostly conserved

88Tmostly conserved

100Amostly conserved

124Tmostly conserved

130Gvariable

139Amostly conserved

157Cvariable

160Amostly conserved

163Tmostly conserved

166Gvariable

172Tmostly conserved

190Amostly conserved

202Amostly conserved

214Amostly conserved

226Tmostly conserved

232Tmostly conserved

235Cmostly conserved

238Cvariable

241Tmostly conserved

268Amostly conserved

271Tvariable

274Cmostly conserved

278Tmostly conserved

280Amostly conserved

283Tmostly conserved

284Cmostly conserved

286Tmostly conserved

291Cvariable

295Amostly conserved

307Tmostly conserved

313Tmostly conserved

319Tmostly conserved

337Gmostly conserved

355Avariable

358Tmostly conserved

361Cmostly conserved

367Tmostly conserved

370Amostly conserved

379Tmostly conserved

382Tmostly conserved

385Tmostly conserved

391Amostly conserved

401Cvariable

403Avariable

407Tmostly conserved

415Amostly conserved

421Tmostly conserved

427Tmostly conserved

445Tmostly conserved

448Tmostly conserved

451Amostly conserved

454Tmostly conserved

460Tmostly conserved

475Cmostly conserved

478Amostly conserved

490Tmostly conserved

512Gvariable

517Amostly conserved

523Tmostly conserved

526Amostly conserved

529Tmostly conserved

532Tmostly conserved

533Cmostly conserved

535Tmostly conserved

547Amostly conserved

556Tmostly conserved

557Tmostly conserved

565Avariable

574Amostly conserved

581Tmostly conserved

586Tmostly conserved

589Tmostly conserved

610Tmostly conserved

616Tmostly conserved

622Tmostly conserved

628Amostly conserved

631Amostly conserved

637Tmostly conserved

640Cvariable

641Cvariable

643Amostly conserved

649Gvariable

AACTTTATATTTTATTTTTGGAATTTGAGCTGGAATAGTGGGAACATCTTTAAGTTTATTAATTCGAGCTGAATTGGGAAATCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.4%

Haplotypes23

BINs5

Most divergent pair11.1%

N.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Lygropia tripunctatasame family7.0%Crambus attissame family7.1%Evergestis desertalissame family7.7%Evergestis vinctalissame family8.1%Diaphania eleganssame family8.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type486 records

Wild obs. + sensor452

Museum / vouchered34

Range

Area of Occupancy AOO1 240 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 220≤1 km 109≤10 km 21>10 km 44

394 georeferenced · 58 without coordinates

Open the mapobservation + sensor452

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy82% within 1 km

≤100 m 3≤1 km 6≤10 km 1>10 km 1

11 georeferenced · 23 without coordinates

Open the institutions mapphysical evidence34

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	6
CUlocation not on record	5
Ciudad de México, MX	2
Cornell University Insect Collectionlocation not on record	2
Centre for Biodiversity Genomicslocation not on record	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Albuquerque, US	1
NNWlocation not on record	1
Smithsonian Tropical Research Institutelocation not on record	1
University of Copenhagen, Natural History Museum of Denmark, Zoological Museumlocation not on record	1
East Lansing, US	1
University of Central Floridalocation not on record	1
National Biodiversity Institute, Costa Ricalocation not on record	1

13 institutions · 25 of 34 vouchered records shown · 9 without an institution code

09Environmental DNA39 detections

Where the DNA of Argyria lacteella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found39

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 39 detections have coordinates

Open the map3 countries0

1. Forest & Woodland|1.6. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.1 °C 19.2–27.1

Seasonal swing summer↔winter14.3 °C

Max temp (day)31.4 °C 25.1–31.8

Min temp (night)22.2 °C 14.6–23.8

Precipitation182 mm/mo 70.0–238

Air humidity61.6 % 57.5–62.6

Moisture balance29.6 mm/mo -106–456

Vapour deficit1,263 Pa 952–1,371

Wind speed2.10 m/s 1.90–5.30

Cloud cover34.1 % 28.6–36.6

CHELSA 1981–2010, ~9 km grid, at location & month of 36 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)