Argyreia nervosa

(Burm.fil.) Bojer · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Solanales/Convolvulaceae/Argyreia

At a glance

Occurrence records606

Data sources13

Biological traits29

DNA specimens0

eDNA detections7

Sources13 archives

Databases and archives Argyreia nervosa's data was compiled from.

WikipediaWikimedia Foundation12 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility606 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

dukesphytochemcompounds

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources29 traits

Chemical compositionDukesPhytochem · LOTUS · NPASS43 compounds

Occurrence & distributionGBIF606 records

Environmental DNA1 datasets · 2 countries7 detections

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 30

01Narrative

Argyreia nervosa is a perennial climbing vine native to the Indian subcontinent and introduced to numerous areas worldwide, including Hawaii, Africa, and the Caribbean. Though it can be invasive, it is often prized for its aesthetic and medicinal value. Common names include Hawaiian baby woodrose, adhoguda अधोगुडा or vidhara विधारा (Sanskrit), elephant creeper and woolly morning glory. Its seeds are known for their powerful entheogenic properties, greater or similar to those of Ipomoea species, with users reporting significant psychedelic and spiritual experiences. The two botanical varieties are A. n. var. nervosa described here, and A. n. var. speciosa, which are used in Ayurvedic medicine for their medicinal value. Argyreia nervosa seeds contain various ergoline alkaloids such as ergine. A study reported stereoisomers of ergine to be found in the seeds at a concentration of 0.325% of dry weight. A more recent study reported presence of ergometrine, lysergol, lysergic acid and other alkaloids that contribute to its pharmacological effects.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYAusTraitsGIFT

Size & morphology10

Fruit length17.5 mm

Fruit width17.5 mm

Leaf length200 mm

Leaf length max300 mm

Leaf length min100 mm

Leaf width165 mm

Leaf width max250 mm

Leaf width min80 mm

Plant height10 m

Seed length5.5 mm

Life cycle & reproduction5

Flowering timeyyyyyynnnnnn

Life formliana

Life spanperennial

Raunkiær life formphanerophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climateseasonally dry tropical

Climberobligatory

Elevation max1 000 m

Elevation min0 m

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: climber_herbaceous · TRY: Climber

Habitat GIFTÁrea Antrópica

Woodinesswoody

⚠ sources differ — TRY: woody · AusTraits: herbaceous woody · GIFT: variable

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

03Chemical composition43 compounds

Compounds documented for Argyreia nervosa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

💊 Medicinal use documented

Compound class profile5 classes

Isoquinoline alkaloids $ Tetrahydroisoquinoline alkaloids8

Flavones4

Ergot alkaloids2

Stigmastane steroids2

Aporphine alkaloids2

Documented compounds43 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-2-N-Methylfangchinoline	present	NPASS
(+)-2-N-Methyltetrandrine	present	NPASS
(1R)-2-(dimethylamino)-1-naphtho[2,1-g][1,3]benzodioxol-5-ylethanol	present	NPASS
(1S,14S,30R)-9,20,25-trimethoxy-15,30-dimethyl-30-oxido-7,23-dioxa-15-aza-30-azoniaheptacyclo[22.6.2.23,6.18,12.114,18.027,31.022,33]hexatriaconta-3(36),4,6(35),8,10,12(34),18,20,22(33),24,26,31-dodecaen-21-ol	present	NPASS
(3S,8R,9R,10R,13R,14R,17R)-17-[(2R,5R)-5-ethyl-6-methylheptan-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol	present	LOTUS
(3S,8S,9S,10R,13R,14S,17R)-17-[(2R,5S)-5,6-dimethylheptan-2-yl]-10,13-dimethyl-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,2,3,4,7,8,9,12,14,15,16,17-dodecahydrocyclopenta[a]phenanthren-11-one	present	LOTUS
(8alpha)-9,10-Didehydro-8-hydroxy-6-methylergoline-8-methanol	present	NPASS
1-Isotetrandrine	present	NPASS
13-Methyl-5,7,19,21-tetraoxa-13-azahexacyclo[10.10.1.02,10.04,8.016,23.018,22]tricosa-1,3,8,10,12(23),16,18(22)-heptaene-14,15-dione	present	NPASS
2,9,10-trimethoxy-6,7-dihydro-5H-isoquinolino[2,1-b]isoquinolin-7-ium-3-one	present	NPASS

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyreia nervosa has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences10

eDNA detections7

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMN825568.1 ↗264 bp

ACGT

GTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCGGCA …

Ipomoea nervosa voucher VB-2254 small subunit ribosomal RNA gene and internal transcribed spacer 1, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL3★ITS5

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Argyreia nervosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 30 n = 15

Ploidydiploid inferred

Chromosome records30–302n range30median30mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 303×CCDB · book-indian_vol1 · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-indian_vol1 — Watanabe, K. 1939 (D. 1955)

CCDB · book-fedorov — Watanabe K. 1939 (D. 1955)

CCDB · book-atlas-flowering-plants — Watanabe 1939

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

07Deep time~14 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin14 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type606 records

Wild obs. + sensor458

Museum / vouchered144

Other4

Origin

Native1

Range

Area of Occupancy AOO1 556 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy59% within 1 km

≤100 m 147≤1 km 21≤10 km 80>10 km 38

286 georeferenced · 172 without coordinates

Open the mapobservation + sensor458

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy85% within 1 km

≤100 m 3≤1 km 32≤10 km 2>10 km 4

41 georeferenced · 103 without coordinates

Open the institutions mapphysical evidence144

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions24 of 41 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Baroda, IN	34
University of Stellenboschlocation not on record	10
Miami, US	8
Taipei, TW	7
HNBlocation not on record	6
Bronx, US	6
Saint Louis, US	6
Adam Mickiewicz University in Poznańlocation not on record	4
BISHlocation not on record	3
Paris, FR	3
Honolulu, US	3
Kew, GB	2
Leiden University Medical Centerlocation not on record	2
Tsukuba, JP	2
Taipei, TW	2
Durban, ZA	2
Chicago, US	2
Tampa, US	2
Seropédica, BR	1
UnBlocation not on record	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Denver, US	1
UEMlocation not on record	1
Guilin, CN	1
MeiseBGlocation not on record	1
Guangzhou, CN	1
Frankfurt am Main	1
Auckland, NZ	1
UNICAMPlocation not on record	1
Nishihara, JP	1
Wlocation not on record	1
Madison, US	1
Sendai, JP	1
Managua, NI	1
Forest Herbarium Ibadan (FHI)location not on record	1
Istituto Agrario Castelnuovolocation not on record	1
Jena Microbial Resource Collectionlocation not on record	1
TAIElocation not on record	1
Bloomington, US	1
UFRRJlocation not on record	1
UNIVILLElocation not on record	1

41 institutions · 127 of 144 vouchered records shown · 17 without an institution code

09Environmental DNA7 detections

Where the DNA of Argyreia nervosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.2 °C 17.6–26.8

Seasonal swing summer↔winter13.7 °C

Max temp (day)29.5 °C 24.0–33.1

Min temp (night)14.8 °C 10.9–20.5

Precipitation7.80 mm/mo 2.20–22.2

Air humidity50.7 % 45.5–53.8

Moisture balance-118 mm/mo -126–-110

Vapour deficit1,486 Pa 979–1,786

Wind speed2.60 m/s 2.30–3.30

Cloud cover16.0 % 6.30–26.0

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)