Argyreia cuneata

(Willd.) Ker Gawl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Solanales/Convolvulaceae/Argyreia

At a glance

Occurrence records92

Data sources8

Biological traits3

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Argyreia cuneata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility92 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources3 traits

Chemical compositionLOTUS9 compounds

Occurrence & distributionGBIF92 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 30

01Narrative

الآرغرية الإسفينية هي شُجيرة متسلقة مُعمرة تستوطن شبه القارة الهندية، وهي قريبة من الآرغرية العصبية.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRY

Life cycle & reproduction1

Life formshrub

Habitat & environment2

Climateseasonally dry tropical

Growth formclimber

03Chemical composition9 compounds

Compounds documented for Argyreia cuneata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Unsaturated fatty acids4

Branched fatty acids $ Unsaturated fatty acids2

Carbocyclic fatty acids2

Hydroxy fatty acids $ Other Octadecanoids1

Documented compounds9 total

Tissue Source Quantified only

Compound	Amount	Source
alpha-Linolenic acid	present	LOTUS
Linonelic acid	present	LOTUS
Malvalic acid	present	LOTUS
myristate	present	LOTUS
oleate	present	LOTUS
palmitate	present	LOTUS
Ricinoleic Acid	present	LOTUS
stearate	present	LOTUS
Sterculic acid	present	LOTUS

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyreia cuneata has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSJX974573.1 ↗594 bp

ACGT

TCGAAACCTGCACAGCAGAACGACCAGAGAACACGTTTGTTATTCACTCCTGGTTCGGGGCGAGTCCCCCCTCCTCGGGGGAGGGCTAGC …

Argyreia cuneata internal transcribed spacer 1, partial sequence; 5,8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Argyreia cuneata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 30 n = 15

Ploidydiploid inferred

Chromosome records30–302n range30median30mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 302×CCDB · ipcn-api-dl · CCDB · book-indian_vol1

CCDB · ipcn-api-dl — Sampathkumar, R. 1979. Karyomorphological studies on some South Indian Convolvulaceae. Cytologia 44: 275–286.

CCDB · book-indian_vol1 — Sampathkumar, R. 1971, 1979

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type92 records

Wild obs. + sensor73

Museum / vouchered19

Range

Area of Occupancy AOO252 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 13≤1 km 29≤10 km 10>10 km 5

57 georeferenced · 16 without coordinates

Open the mapobservation + sensor73

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 18 without coordinates

Open the institutions mapphysical evidence19

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pondicherry, IN	15
Baroda, IN	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
McWane Science Centerlocation not on record	1
Dehra Dun, IN	1

5 institutions · 19 of 19 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)