Argyranthemum tenerifae

Humphries · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Argyranthemum

At a glance

Occurrence records308

Data sources7

Biological traits13

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Argyranthemum tenerifae's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility308 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources13 traits

Occurrence & distributionGBIF308 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 18

01Narrative

La margherita del Teide è una pianta della famiglia delle Asteracee, endemica delle aree sommitali del monte Teide, sull'isola di Tenerife. Non è propriamente una margherita.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Size & morphology2

Plant height max0.5 m

Plant height min0.3 m

Life cycle & reproduction5

Flower colourwhite

Flower length max13 mm

Flowering endOct

Flowering startMar

Life spanperennial

Habitat & environment5

Elevation max2 300 m

Elevation min1 900 m

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: herb/shrub

Leaf formoblong

Woodinessvariable

⚠ sources differ — TRY: non-woody/woody · GIFT: non-woody

Other traits1

Inflorescencecyme

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyranthemum tenerifae has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSL77793.1 ↗459 bp

ACGT

TCGAACCCTGCAAAGCAGAACGACCCGTGAACACGTAATAATAACCGAGCNCCGAGTGGGTTAAGCGCTTTGTTTGATCCTCTCGGTGCT …

Argyranthemum tenerifae internal transcribed spacer internal transcribed spacer, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Argyranthemum tenerifae carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 183×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · kew

CCDB · ipcn-api-dl — Suda, J., T. Kyncl & R. Freiová. 2003. Nuclear DNA amounts in Macaronesian angiosperms. Ann. Bot. (Oxford) 92: 153–164.

CCDB · book-ipcn75-78 — Humphries 197 5

CCDB · kew — Suda J, Kyncl T, Freiova R. 2003. Nuclear DNA amounts in Macaronesian angiosperms. Annals of Botany 92: 153-164.

n 91×CCDB · book-ipcn75-78

CCDB · book-ipcn75-78 — Humphries 197 5

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type308 records

Wild obs. + sensor288

Museum / vouchered20

Range

Area of Occupancy AOO228 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 119≤1 km 38≤10 km 66>10 km 11

234 georeferenced · 54 without coordinates

Open the mapobservation + sensor288

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤1 km 4≤10 km 2

6 georeferenced · 14 without coordinates

Open the institutions mapphysical evidence20

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
LDlocation not on record	4
Saint Louis, US	2
WAGlocation not on record	2
College of the Atlantic, Museumlocation not on record	2
Xiamen, CN	2
Barcelona, ES	2
BRNUlocation not on record	1
Madrid, ES	1
Clocation not on record	1

9 institutions · 17 of 20 vouchered records shown · 3 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)