Argyranthemum foeniculaceum

(Willd.) Webb ex Sch.Bip. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Argyranthemum

At a glance

Occurrence records242

Data sources12

Biological traits21

DNA specimens2

eDNA detections1

Sources12 archives

Databases and archives Argyranthemum foeniculaceum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility242 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources21 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF242 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Argyranthemum foeniculaceum, called the Canary Island marguerite, is native to the Canary Islands, (part of Spain).Humphries, C. J. 1976. A revision of the Macaronesian genus Argyranthemum Webb ex Schultz Bip. (Compositae–Anthemideae). Bull. Br. Mus. (Nat. Hist.), Bot. 5: 147–240.Flora vascular de Canarias, Argyranthemum foeniculaceum (Willd.) Webb ex Sch.Bip. color photo, caption in Spanish It is widely cultivated as an ornamental and naturalized in CaliforniaFlora of North America Vol. 19, 20 and 21 Page 552 Argyranthemum foeniculaceum (Willdenow) Webb ex Schultz-Bipontinus in P. B. Webb and S. Berthelot, Hist. Nat. Îles Canaries. 3(2,75): 262. 1844.Calflora taxon report, University of California, Argyranthemum foeniculaceum (Willd.) Schultz-Bip. Canary Island margeurite, dill daisy and Australia.Atlas of Living Australia, Argyranthemum frutescens subsp. foeniculaceum (Pit.) Humphries,

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Size & morphology3

Plant height0.4 m

Plant height max1 m

Plant height min0.6 m

Life cycle & reproduction8

Dehiscenceindehiscent

Flower colourwhite

Flower length max22 mm

Flower length min14 mm

Flowering endSep

Flowering startFeb

Life spanperennial

Lifespan years9 years

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climberself-supporting

Elevation max1 100 m

Elevation min200 m

Epiphyteterrestrial

Fruit typeachene

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: Subshrub

Leaf formlinear

Woodinessvariable

⚠ sources differ — TRY: non-woody/woody · GIFT: woody

03Chemical composition2 compounds

Compounds documented for Argyranthemum foeniculaceum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Germacrane sesquiterpenoids1

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Frutescin-Chrysanthemum segetum (corn marigold)		present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyranthemum foeniculaceum has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences5

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAF155307.1 ↗207 bp

ACGT

AATCGCTTCGCCCCCCGCAAATCTATGTTGGGGGCGGATATTGGTCTCCCGTGCTCATGGCGTGGTTGGCCAAAATAGGAGTCCCTTCGA …

Argyranthemum foeniculaceum internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcLa★ITS5★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Argyranthemum foeniculaceum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 186×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · eflora +2

CCDB · ipcn-api-dl — Humphries, C. J. 1975. Cytological studies in the Macaronesian genus Argyranthemum (Compositae: Anthemideae). Bot. Not. 128. 239–255.

CCDB · book-ipcn67-71 — BORGEN L. 1970. Chromosome numbers of Macaronesian flowering plants. Nytt Mag. Bot. 17: 145-161.

CCDB · book-ipcn67-71 — BORGEN, L. 1969. Chromosome numbers of vascular plants from the Canary Islands, with special reference to the occurence of polyploidy. Nytt Magasin for Botanik 16: 18-121.

CCDB · eflora

CCDB · book-atlas-flowering-plants — Harling 1951b

CCDB · kew — Suda J, Kyncl T, Freiova R. 2003. Nuclear DNA amounts in Macaronesian angiosperms. Annals of Botany 92: 153-164.

n 95×CCDB · book-ipcn65 · CCDB · ipcn-api-dl · CCDB · book-ipcn73-74 +1

CCDB · book-ipcn65 — Linder & L. 1965

CCDB · ipcn-api-dl — Humphries, C. J. 1975. Cytological studies in the Macaronesian genus Argyranthemum (Compositae: Anthemideae). Bot. Not. 128. 239–255.

CCDB · book-ipcn73-74 — BRAMWELL, D., C.J. HUMPHRIES, B.G. MURRAY, I S.J. OWENS. 1971. Chromosome numbers in plants from the Canary Islands. Bot. Notiser 12/ 376-382. i

CCDB · book-ipcn73-74 — POWELL, A.M., D.W. KYHOS, & P.H. RAVEN. 1974. Chromosome numbers in Compositae. X. Amer. J. Bot. 61: 909-913.

CCDB · Cave1958 — Larsen 1958b

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type242 records

Wild obs. + sensor178

Museum / vouchered64

Range

Area of Occupancy AOO344 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy53% within 1 km

≤100 m 68≤1 km 17≤10 km 73>10 km 2

160 georeferenced · 18 without coordinates

Open the mapobservation + sensor178

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤100 m 3≤1 km 18≤10 km 7

28 georeferenced · 36 without coordinates

Open the institutions mapphysical evidence64

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Riverside, US	8
Claremont, US	7
Canadian Department of Agriculturelocation not on record	5
CASlocation not on record	4
Davis, US	4
San Diego, US	4
JBSlocation not on record	3
LDlocation not on record	3
Santa Barbara, US	3
Irvine, US	1
San Diego Natural History Museum, Herbariumlocation not on record	1
US	1
Ivano-Frankivsk, UA	1
BRNUlocation not on record	1
Arcata, US	1
UEMlocation not on record	1
College of the Atlantic, Museumlocation not on record	1
Bern, CH	1
San Luis Obispo, US	1
Santa Cruz, US	1

20 institutions · 52 of 64 vouchered records shown · 12 without an institution code

09Environmental DNA1 detections

Where the DNA of Argyranthemum foeniculaceum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

on bluffs in sage scrub, on bluffs in sage s…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.1 °C 17.1–17.1

Seasonal swing summer↔winter9.50 °C

Max temp (day)22.1 °C

Min temp (night)13.1 °C

Precipitation5.30 mm/mo

Air humidity61.9 %

Moisture balance-136 mm/mo

Vapour deficit743 Pa

Wind speed1.90 m/s

Cloud cover25.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)