Argyractis drumalis

Dyar, 1906 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Argyractis

At a glance

Occurrence records77

Data sources7

Biological traits0

DNA specimens6

eDNA detections6

Sources7 archives

Databases and archives Argyractis drumalis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility77 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF77 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD6 specimens

01Narrative

Argyractis drumalis is a moth in the family Crambidae.Natural History Museum Lepidoptera generic names catalog It is found in North America, where it has been recorded from Florida. The length of the forewings is about 5 mm. Adults have been recorded on wing from February to November.mothphotographersgroup The larvae feed on the roots of Pistia stratiotes and Nymphaea species. They are aquatic.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyractis drumalis has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

eDNA detections6

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Diversity (π)1.9%

Haplotypes1

BIN1

Where individuals differ — all 37 variable positions, in barcode order

19Tmostly conserved

21Gmostly conserved

23Amostly conserved

26Tmostly conserved

27Gmostly conserved

28Amostly conserved

29Tmostly conserved

30Cmostly conserved

31Tmostly conserved

33Gmostly conserved

35Amostly conserved

36Tmostly conserved

38Amostly conserved

40Tmostly conserved

42Gmostly conserved

44Amostly conserved

45Cmostly conserved

47Tmostly conserved

48Cmostly conserved

51Tmostly conserved

53Amostly conserved

54Gmostly conserved

55Amostly conserved

57Tmostly conserved

58Amostly conserved

60Tmostly conserved

62Amostly conserved

64Tmostly conserved

65Cmostly conserved

66Gmostly conserved

67Amostly conserved

68Gmostly conserved

69Cmostly conserved

70Tmostly conserved

71Gmostly conserved

73Amostly conserved

75Tmostly conserved

AACTTTATATTTTATTTTTGGAATTTGATCTGGAATAATTGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGAACCCCTGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Euchloe olympiasame order10.6%Usingeriessa onyxalissame family10.8%Omiodes simialissame family11.2%Euphyia unangulatasame order11.6%Osminia donahueorumsame order11.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type77 records

Wild obs. + sensor51

Museum / vouchered26

Range

Area of Occupancy AOO160 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 21≤1 km 6≤10 km 1>10 km 7

35 georeferenced · 16 without coordinates

Open the mapobservation + sensor51

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 26 records without

Open the institutions mapphysical evidence26

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	20
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	5
Florida Museum of Natural History, McGuire Center for Lepidoptera and Biodiversitylocation not on record	1

3 institutions · 26 of 26 vouchered records shown

09Environmental DNA6 detections

Where the DNA of Argyractis drumalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

Hammock by canal

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.4 °C 23.2–24.4

Seasonal swing summer↔winter10.5 °C

Max temp (day)28.7 °C 28.0–28.7

Min temp (night)20.6 °C 19.2–20.6

Precipitation90.3 mm/mo 90.3–109

Air humidity60.6 % 60.0–60.6

Moisture balance-26.9 mm/mo -26.9–-17.1

Vapour deficit1,199 Pa 1,146–1,199

Wind speed2.70 m/s 2.70–3.00

Cloud cover30.6 % 30.6–32.5

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)