Argyra vestita

(Wiedemann, 1817) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Dolichopodidae/Argyra

At a glance

Occurrence records534

Data sources7

Biological traits2

DNA specimens61

eDNA detections27

Sources7 archives

Databases and archives Argyra vestita's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility534 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI27 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics61 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF534 records

Environmental DNA1 datasets · 3 countries27 detections

DNA & barcodingBOLD61 specimens

01Narrative

Argyra vestita is a species of fly in the family Dolichopodidae. It is distributed in Europe.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)predator

Feeding guild (larval)predator

05DNA & barcoding61 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyra vestita has left across the world's sequence archives.

At a glance

DNA specimens61

BINs1

Marker genes2

eDNA detections27

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus56 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

98Avariable

371Amostly conserved

527Tvariable

CCCTATATTTTATTTTTGGAGCCTGAGCTGGAATGGTAGGAACTTCTTTAAGTATTATTGTACGTATAGAATTAGGTCATCCAGGAGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.21%

Haplotypes8

BIN1

Most divergent pair0.61%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anopheles azaniaesame order12.2%Rhamphomyia hellenisame order12.6%Sphaerophoria pyrrhinasame order12.8%Rhamphomyia geniculatasame order12.8%Sphaerophoria potentillaesame order13.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type534 records

Wild obs. + sensor311

Museum / vouchered223

Range

Area of Occupancy AOO1 052 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 215≤1 km 36≤10 km 60

311 georeferenced

Open the mapobservation + sensor311

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 55≤1 km 44≤10 km 96>10 km 2

197 georeferenced · 26 without coordinates

Open the institutions mapphysical evidence223

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Naturalis (NL)location not on record	41
MZLUlocation not on record	36
Copenhagen, DK	30
SLU Artdatabankenlocation not on record	13
DFFW2016location not on record	11
Stockholm, SE	10
DFlocation not on record	7
South Kensington, GB	6
RBINS (BE)location not on record	4
Natural History Museum, Londonlocation not on record	3
CBDClocation not on record	2
SGAV-and-NHMDlocation not on record	2
DFFW1981location not on record	2
BioFokuslocation not on record	2
Gothenburg, SE	1
DFFW2018location not on record	1
Naturalis (previous Rijksmuseum van Natuurlijke Historie) (NL)location not on record	1
Helsinki, FI	1
NHMOlocation not on record	1

19 institutions · 174 of 223 vouchered records shown · 49 without an institution code

09Environmental DNA27 detections

Where the DNA of Argyra vestita was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found27

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 27 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 13.5–16.3

Seasonal swing summer↔winter10.0 °C

Max temp (day)17.0 °C 15.5–18.4

Min temp (night)11.7 °C 9.70–15.2

Precipitation91.0 mm/mo 47.2–102

Air humidity63.1 % 59.6–64.0

Moisture balance-21.3 mm/mo

Vapour deficit628 Pa 585–677

Wind speed5.00 m/s

Cloud cover51.4 % 41.0–54.9

CHELSA 1981–2010, ~9 km grid, at location & month of 25 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)