Argylia uspallatensis

DC. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Bignoniaceae/Argylia

At a glance

Occurrence records85

Data sources5

Biological traits12

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Argylia uspallatensis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility85 records↗

NCBIUS National Library of Medicinesequences↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF85 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 30

01Narrative

Argylia uspallatensis is a species of perennial plant in the family Bignoniaceae. It is found in Chile and Argentina.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formperennial or tuberous geophyte

Life spanperennial

Lifeform raunkiaer detailedgeophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max4 100 m

Elevation min1 700 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argylia uspallatensis has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMZ312475.1 ↗735 bpChile · 1926

ACGT

TGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTACAAAGTAGACCGCGAACACGTTTCT …

Argylia uspallatensis voucher CONC 75331 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Argylia uspallatensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 30 n = 15

Chromosome records30–302n range30median30mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 303×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-fedorov — Covas, Cherubini 1946

CCDB · book-fedorov — D. 1955)

CCDB · book-atlas-flowering-plants — Covas & S. 1946

08Occurrence & distribution

Record type85 records

Wild obs. + sensor34

Museum / vouchered51

Origin

Native8

Range

Area of Occupancy AOO176 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 7≤1 km 6≤10 km 5

18 georeferenced · 16 without coordinates

Open the mapobservation + sensor34

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 51 records without

Open the institutions mapphysical evidence51

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Isidro, AR	15
Córdoba, AR	9
Castelar, AR	3
Saint Louis, US	3
Laboratory of Palaeontologylocation not on record	2
Berlin, DE	2
Boise, US	2
INTAlocation not on record	2
Wlocation not on record	2
Herbario Universidad de Concepciónlocation not on record	1
Mendoza, AR	1
BAlocation not on record	1
Museo Nacional de Costa Rica (MNCR)location not on record	1
Kew, GB	1
Zlocation not on record	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Fundación Miguel Lillolocation not on record	1
Valparaiso, CL	1
MCNAMlocation not on record	1
University of Stellenboschlocation not on record	1

20 institutions · 51 of 51 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)