Argylia radiata

(L.) D.Don · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Bignoniaceae/Argylia

At a glance

Occurrence records556

Data sources5

Biological traits16

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Argylia radiata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility556 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Chemical compositionLOTUS22 compounds

Occurrence & distributionGBIF556 records

DNA & barcodingNCBIsequences

01Narrative

Argylia conaiensis là một loài thực vật có hoa trong họ Chùm ớt. Loài này được Ravenna mô tả khoa học đầu tiên năm 2007.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass4.82 mg

Seed mass max5.49 mg

Seed mass min4.14 mg

Life cycle & reproduction3

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Elevation max800 m

Elevation min1 000 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

03Chemical composition22 compounds

Compounds documented for Argylia radiata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Iridoids monoterpenoids22

Documented compounds22 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,4aR,7R,7aR)-7-hydroxy-7-methyl-1-[(2R,3S,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-4a,5,6,7a-tetrahydro-1H-cyclopenta[c]pyran-4-carboxylic acid	present	LOTUS
(1R,4aS,7S,7aS)-4a-hydroxy-7-methyl-1-[(2R,3S,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-5,6,7,7a-tetrahydro-1H-cyclopenta[c]pyran-4-carbaldehyde	present	LOTUS
(2S,3R,4S,5S,6R)-2-[[(1S,2S,4S,5S,6S,10S)-5-hydroxy-2-(hydroxymethyl)-3,9-dioxatricyclo[4.4.0.02,4]dec-7-en-10-yl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS
(4aR,7S,7aR)-7-hydroxy-7-methyl-1,4,4a,5,6,7a-hexahydrocyclopenta[c]pyran-3-one	present	LOTUS
8-Epideoxyloganic acid	present	LOTUS
8-Epideoxyloganin	present	LOTUS
[(1S,2S,4S,5S,6R,10S)-2-(hydroxymethyl)-10-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3,9-dioxatricyclo[4.4.0.02,4]dec-7-en-5-yl] (1S,4aS,7R,7aR)-7-methyl-1-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,4a,5,6,7,7a-hexahydrocyclopenta[c]pyran-4-carboxylate	present	LOTUS
[(1S,2S,4S,5S,6R,10S)-2-(hydroxymethyl)-10-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3,9-dioxatricyclo[4.4.0.02,4]dec-7-en-5-yl] (1S,4aS,7S,7aR)-7-methyl-1-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,4a,5,6,7,7a-hexahydrocyclopenta[c]pyran-4-carboxylate	present	LOTUS
[(1S,2S,4S,5S,6R,10S)-2-(hydroxymethyl)-10-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3,9-dioxatricyclo[4.4.0.02,4]decan-5-yl] (1S,4aS,7R,7aR)-7-methyl-1-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,4a,5,6,7,7a-hexahydrocyclopenta[c]pyran-4-carboxylate	present	LOTUS
[(1S,2S,4S,5S,6S,10S)-2-(hydroxymethyl)-10-[(2S,3S,4R,5S,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3,9-dioxatricyclo[4.4.0.02,4]dec-7-en-5-yl] (1S,4aS,7S,7aS)-7-hydroxy-7-methyl-1-[(2S,3S,4S,5S,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-4a,5,6,7a-tetrahydro-1H-cyclopenta[c]pyran-4-carboxylate	present	LOTUS

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argylia radiata has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMW854033.1 ↗568 bp

ACGT

TCGAAACCTACAAAGTAGACCGCGAACACGTTTCTAATCACTTGGGGTGATCGGTGTTGTGGGAGACCACATGCTGAAATCCCCTCCCGT …

Argylia radiata voucher FLSP 0466 (NY) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

08Occurrence & distribution

Record type556 records

Wild obs. + sensor480

Museum / vouchered75

Cultivated / captive1

Origin

Native1

Range

Area of Occupancy AOO1 488 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 227≤1 km 71≤10 km 60>10 km 29

387 georeferenced · 93 without coordinates

Open the mapobservation + sensor480

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 74 without coordinates

Open the institutions mapphysical evidence75

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chicago, US	15
Valparaiso, CL	13
Edinburgh, GB	9
Saint Louis, US	8
MeiseBGlocation not on record	5
Kew, GB	5
UChlocation not on record	4
Valparaíso, CL	3
UNESP-FCAlocation not on record	2
Severin-McDaniel Insect Collectionlocation not on record	2
ASUlocation not on record	2
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Frankfurt am Main	1
Córdoba, AR	1
MAlocation not on record	1
Museo Nacional de Costa Rica (MNCR)location not on record	1
Davis, US	1
Riverside, US	1

18 institutions · 75 of 75 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)