Argulus japonicus

Thiele, 1900 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Maxillopoda/Arguloida/Argulidae/Argulus

At a glance

Occurrence records43

Data sources8

Biological traits2

DNA specimens43

eDNA detections13

Sources8 archives

Databases and archives Argulus japonicus's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility43 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics43 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF43 records

Environmental DNA1 datasets · 4 countries13 detections

DNA & barcodingBOLD43 specimens

01Narrative

Argulus japonicus, common name Japanese fishlouse or Japanese fish louse, is a species of crustaceans in the family Argulidae, the fish lice. This species is light brown in colour and may be between 4 and 9 mm long and 3 to 6 mm wide. It has a stumpy tail, and is shaped somewhat like a round shield. The female and male A. japonicus are phenotypically distinct, categorizing them as a dioecious species. Although they are not drastically different, their transparent skin highlights the minor differences such as the different copulatory accessories.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat freshwateryes

Habitat zonedemersal

05DNA & barcoding43 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argulus japonicus has left across the world's sequence archives.

At a glance

DNA specimens43

BINs6

Marker genes2

eDNA detections13

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P647 bp consensus21 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 16 variable positions, in barcode order

69Avariable

72Avariable

225Amostly conserved

234Tmostly conserved

285Avariable

291Amostly conserved

474Cmostly conserved

483Amostly conserved

486Amostly conserved

489Gmostly conserved

492Tmostly conserved

495Amostly conserved

498Amostly conserved

501Tmostly conserved

504Amostly conserved

552Amostly conserved

CTTTATTATATTTTTGGTGCAGCATCTGGCTTAATTGGGGCTTCTTTAAGATTAATAATTCGATTAGAATTATCTATGCCTGGTTCTTTA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.0%

Haplotypes6

BINs2

Most divergent pair1.7%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argulus americanussame genus6.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_088557 ↗ · 13 protein · 22 tRNA · 2 rRNA

COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6ND1CYTBND2rrn16rrn12

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type43 records

Wild obs. + sensor8

Museum / vouchered24

Other11

Range

Area of Occupancy AOO156 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 5≤1 km 1≤10 km 1>10 km 1

8 georeferenced

Open the mapobservation + sensor8

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 23 without coordinates

Open the institutions mapphysical evidence24

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Sydney, AU	5
Museums Victorialocation not on record	3
South Kensington, GB	2
Washington, US	2
	2
Western Australian Museumlocation not on record	2
Museum für Naturkunde Berlin (Zoological Collections)location not on record	1
Natick, US	1

8 institutions · 18 of 24 vouchered records shown · 1 without an institution code

09Environmental DNA13 detections

Where the DNA of Argulus japonicus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.8 °C 10.0–23.5

Seasonal swing summer↔winter23.0 °C

Max temp (day)22.9 °C 15.7–27.6

Min temp (night)12.2 °C 3.10–17.9

Precipitation13.8 mm/mo 0.2–155

Air humidity45.7 % 44.0–57.7

Moisture balance-130 mm/mo -182–31.4

Vapour deficit1,229 Pa 827–1,628

Wind speed4.50 m/s 3.50–4.70

Cloud cover24.1 % 14.2–41.1

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)