Argopleura magdalenensis

(Eigenmann, 1913) · species

image placeholder — illustration coming later

Animalia/Chordata/Characiformes/Characidae/Argopleura

At a glance

Occurrence records7 277

Data sources7

Biological traits5

DNA specimens43

eDNA detections43

Sources7 archives

Databases and archives Argopleura magdalenensis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility7 277 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI43 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics43 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF7 277 records

Environmental DNA1 datasets · 1 countries43 detections

DNA & barcodingBOLD43 specimens

01Narrative

Argopleura magdalenensis is een straalvinnige vissensoort uit de familie van de karperzalmen (Characidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1913 door Eigenmann.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology2

Body length6.01 cm

Body mass3.34 g

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthopelagic

Other traits1

Vulnerability10

05DNA & barcoding43 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argopleura magdalenensis has left across the world's sequence archives.

At a glance

DNA specimens43

BINs2

Marker genes1

eDNA detections43

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P625 bp consensus43 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 22 variable positions, in barcode order

64Tmostly conserved

90Tmostly conserved

189Cvariable

198Cvariable

204Tvariable

216Avariable

219Cvariable

222Tmostly conserved

238Tmostly conserved

255Tvariable

261Avariable

262Tvariable

342Avariable

420Tvariable

423Tvariable

438Gmostly conserved

462Tvariable

540Gvariable

570Cvariable

603Avariable

606Tmostly conserved

609Avariable

GCCGGAATAGTTGGCACAGCCCTTAGCCTTCTAATTCGAGCAGAACTAAGTCAGCCTGGATCCTTACTGGGCGATGATCAAATTTATAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes6

BINs2

Most divergent pair2.9%

S.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Corynopoma riiseisame family10.8%Gephyrocharax atracaudatussame family11.7%Gephyrocharax intermediussame family12.0%Glandulocauda melanopleurasame family12.1%Pseudocorynopoma heterandriasame family12.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type7 277 records

Wild obs. + sensor6 702

Museum / vouchered575

Origin

Native6 245

Range

Area of Occupancy AOO1 244 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 4≤1 km 74

78 georeferenced · 6 624 without coordinates

Open the mapobservation + sensor6 702

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy79% within 1 km

≤100 m 42≤1 km 271≤10 km 74>10 km 8

395 georeferenced · 180 without coordinates

Open the institutions mapphysical evidence575

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Universidad del Tolima (UT)location not on record	253
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	99
Universidad de Antioquia (UdeA)location not on record	68
Universidad Católica de Oriente (UCO)location not on record	59
University of Nebraskalocation not on record	38
Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record	12
Universidad Industrial de Santander (UIS)location not on record	10
Universidad de Caldas (UCaldas)location not on record	4
Museo de Ictiología Carlos Arturo Ardila Rodríguez (CAR)location not on record	3
Washington, US	2
Pontificia Universidad Javeriana (PUJ)location not on record	1
Cambridge, US	1
Celsia Colombia S.A. E.S.P.(CELSIA)location not on record	1
Universidad de los Andes (UniAndes)location not on record	1
Universidad del Valle (UniValle)location not on record	1
Museu Nacional/Universidade Federal do Rio de Janeirolocation not on record	1
Universidad de La Salle (La Salle)location not on record	1

17 institutions · 555 of 575 vouchered records shown · 20 without an institution code

09Environmental DNA43 detections

Where the DNA of Argopleura magdalenensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found43

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 43 detections have coordinates

Open the map1 country0

LoticCuerpo de agua lotico

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.8 °C 16.2–26.2

Seasonal swing summer↔winter1.00 °C

Max temp (day)21.9 °C 19.9–29.8

Min temp (night)13.9 °C 11.0–22.8

Precipitation324 mm/mo 131–671

Air humidity67.4 % 60.3–75.3

Moisture balance209 mm/mo 18.8–567

Vapour deficit744 Pa 457–1,106

Wind speed1.10 m/s 0.7–1.40

Cloud cover38.3 % 28.4–62.2

CHELSA 1981–2010, ~9 km grid, at location & month of 42 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Argopleura magdalenensis

At a glance

Sources7 archives

Size & morphology2

Habitat & environment2

Other traits1

At a glance

Record type7 277 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 17 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type7 277 records