Argophyllum lejourdanii

F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Argophyllaceae/Argophyllum

At a glance

Occurrence records73

Data sources4

Biological traits19

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Argophyllum lejourdanii's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility73 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources19 traits

Occurrence & distributionGBIF73 records

DNA & barcodingNCBIsequences

01Narrative

Argophyllum lejourdanii is a plant in the Argophyllaceae family endemic to a part of north eastern Queensland, Australia. It was described and named in 1863.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRY

Size & morphology8

Fruit length4.5 mm

Fruit width4.5 mm

Leaf length112 mm

Leaf width45 mm

Plant height6 m

Seed length0.5 mm

Seed mass0.607 mg

Seed width0.5 mm

Life cycle & reproduction4

Flowering timeyynnyyyyyyyy

Life formshrub

Life spanperennial

Sex typehermaphrodite

Habitat & environment6

Climatewet tropical

Fruit fleshinessdry

Fruit typecapsule

Growth formshrub tree

Leaf compoundnesssimple

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argophyllum lejourdanii has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

rbcLMW255587.1 ↗152 319 bp

ACGT

TTTTGATGGGCGAACGACGGGAATTGAACCCGCGCATGGTGGATTCACAATCCACTGCCTTGATCCACTTGGCTACATCCGCCCCTCTAC …

Argophyllum lejourdanii voucher CBG9613283 chloroplast, partial genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1

plant barcode

08Occurrence & distribution

Record type73 records

Museum / vouchered70

Cultivated / captive2

Other1

Origin

Native4

Range

Area of Occupancy AOO160 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤100 m 10≤1 km 5≤10 km 30>10 km 6

51 georeferenced · 19 without coordinates

Open the institutions mapphysical evidence70

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

10Collections & institutions

Holding institutions10 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	21
Brisbane, AU	13
Smithfield, AU	8
Paris, FR	6
Mount Annan, AU	4
Kew, GB	3
Saint Louis, US	3
Palmerston, AU	3
Canberra, AU	3
Adelaide, AU	1
Honolulu, US	1

11 institutions · 66 of 70 vouchered records shown · 4 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)