Argonectes longiceps

(Kner, 1858) · species

image placeholder — illustration coming later

Animalia/Chordata/Characiformes/Hemiodontidae/Argonectes

At a glance

Occurrence records241

Data sources6

Biological traits5

DNA specimens5

eDNA detections5

Sources6 archives

Databases and archives Argonectes longiceps's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility241 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF241 records

Environmental DNA1 datasets · 0 countries5 detections

DNA & barcodingBOLD5 specimens

01Narrative

Argonectes longiceps is een straalvinnige vissensoort uit de familie van de penseelvissen (Hemiodontidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1858 door Kner.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology2

Body length26 cm

Body mass312 g

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthopelagic

Other traits1

Vulnerability21.72

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argonectes longiceps has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

eDNA detections5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P570 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.25%

Haplotypes2

BIN1

Most divergent pair0.35%

Where individuals differ — all 3 variable positions, in barcode order

153Amostly conserved

435Cmostly conserved

490Tvariable

GCCGGAATAGTTGGCACAGCCCTTAGTCTCTTAATCCGAGCAGAGCTTAGCCAGCCAGGATCTCTCCTGGGCGACGACCAGATTTATAAT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argonectes robertsisame genus4.9%Hemiodus unimaculatussame family12.2%Hemiodus tocantinensissame family12.6%Bivibranchia bimaculatasame family12.8%Anodus orinocensissame family12.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type241 records

Wild obs. + sensor23

Museum / vouchered218

Origin

Native5

Range

Area of Occupancy AOO620 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 5

5 georeferenced · 18 without coordinates

Open the mapobservation + sensor23

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 1≤1 km 3>10 km 2

6 georeferenced · 212 without coordinates

Open the institutions mapphysical evidence218

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Instituto de Biodiversidad de Venezuela - INBIOlocation not on record	86
Museu de Zoologia da Universidade de Sao Paulolocation not on record	27
Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record	23
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	17
Geneva, CH	9
USP-RPlocation not on record	9
Montgomery, US	6
Londrina, BR	6
Toronto, CA	6
PUC-RSlocation not on record	5
Texas Cooperative Wildlife Collectionlocation not on record	5
University of Nebraskalocation not on record	5
Washington, US	4
Cambridge, US	2
Pontificia Universidad Javeriana (PUJ)location not on record	2
Universidad del Tolima (UT)location not on record	2
UNICAMPlocation not on record	2
FishBaselocation not on record	1
Chicago, US	1

19 institutions · 218 of 218 vouchered records shown

09Environmental DNA5 detections

Where the DNA of Argonectes longiceps was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)