Argolamprotes micella

(Denis & Schiffermüller) , 1775 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Gelechiidae/Argolamprotes

At a glance

Occurrence records5 364

Data sources9

Biological traits2

DNA specimens33

eDNA detections81

Sources9 archives

Databases and archives Argolamprotes micella's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 364 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI81 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics33 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF5 364 records

Environmental DNA3 datasets · 9 countries81 detections

DNA & barcodingBOLD33 specimens

Genome at a glanceGoaT · NCBI≈426 Mbp

01Narrative

Argolamprotes micella, the bright neb, is a moth of the family Gelechiidae. It is found in most of Europe, except Ireland, the Iberian Peninsula and most of the Balkan Peninsula.Fauna Europaea Outside of Europe, it is known from Siberia, the Russian Far East, the southern Kuril Islands and Japan.et al. 2010: The gelechiid fauna of the southern Ural Mountains, part II: list of recorded species with taxonomic notes (Lepidoptera: Gelechiidae). Zootaxa, 2367: 1–68. Preview The habitat consists of hedgerows, open woodland and gardens. The wingspan is 10–14 mm.microlepidoptera.nl Adults are on wing in June and July. The larvae feed on Rubus idaeus and Rubus fruticosus. They feed from within the flowering shootsUK Moths and buds.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding33 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argolamprotes micella has left across the world's sequence archives.

At a glance

DNA specimens33

BINs1

Marker genes1

eDNA detections81

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus29 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

148Amostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGTACTTCCCTAAGTTTACTAATTCGTGCCGAATTAGGTAATCCTGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.14%

Haplotypes6

BIN1

Most divergent pair1.4%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Monochroa arundinetellasame family9.1%Teleiopsis motleellasame family9.4%Eutelia catephioidessame order9.7%Eutelia gaedeisame order10.1%Eutelia adulatricoidessame order10.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Argolamprotes micella carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈425 623 986 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Argolamprotes micella0.43 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness99.2% BUSCO

08Occurrence & distribution

Record type5 364 records

Wild obs. + sensor4 789

Museum / vouchered528

Other47

Range

Area of Occupancy AOO8 312 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 2 380≤1 km 1 156≤10 km 1 013>10 km 7

4 556 georeferenced · 233 without coordinates

Open the mapobservation + sensor4 789

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy89% within 1 km

≤100 m 222≤1 km 137≤10 km 44

403 georeferenced · 125 without coordinates

Open the institutions mapphysical evidence528

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	78
DanishLepidopterologicalSocietylocation not on record	69
Tartu, EE	43
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	39
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	30
SLU Artdatabankenlocation not on record	27
Provincia di Livornolocation not on record	22
Kuopio, FI	16
Kushiro City Museumlocation not on record	13
Philadelphia, US	13
ZMAAlocation not on record	11
National Institute of Biological Resourceslocation not on record	8
Stockholm, SE	8
DABUHlocation not on record	8
Tallinn, EE	5
European Distributed Institute of Taxonomy (EDIT)location not on record	5
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	4
Rovaniemi, FI	3
Metsähallituslocation not on record	2
NTNU-VMlocation not on record	2
BioFokuslocation not on record	2
Salzburg, AT	2
ZSMlocation not on record	2
neflocation not on record	2
South Kensington, GB	2
KIRMlocation not on record	1
Research Collection of Richard Heindellocation not on record	1
University of Kaiserslauternlocation not on record	1
Trondheim, NO	1
NTNU University Museum, Department of Natural Historylocation not on record	1
Research Collection of Hartmut Wegnerlocation not on record	1
Natural History Museum, Londonlocation not on record	1

32 institutions · 423 of 528 vouchered records shown · 105 without an institution code

09Environmental DNA81 detections

Where the DNA of Argolamprotes micella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found81

Studies independent surveys3

Countries9

Verifiable raw sequence linked53

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 81 detections have coordinates

Open the map9 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.5 °C 13.7–17.4

Seasonal swing summer↔winter18.4 °C

Max temp (day)20.2 °C 17.1–21.8

Min temp (night)12.5 °C 9.40–13.6

Precipitation84.6 mm/mo 63.7–116

Air humidity60.5 % 58.5–61.8

Moisture balance-29.6 mm/mo -62.2–10.7

Vapour deficit743 Pa 637–829

Wind speed2.70 m/s 2.00–4.30

Cloud cover44.8 % 37.5–54.6

CHELSA 1981–2010, ~9 km grid, at location & month of 81 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Argolamprotes micella

At a glance

Sources9 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type5 364 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 32 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 364 records