Argogorytes fargeii

(Shuckard, 1837) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Crabronidae/Argogorytes

At a glance

Occurrence records1 448

Data sources6

Biological traits2

DNA specimens31

eDNA detections30

Sources6 archives

Databases and archives Argogorytes fargeii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 448 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI30 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics31 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF1 448 records

Environmental DNA2 datasets · 6 countries30 detections

DNA & barcodingBOLD31 specimens

01Narrative

Argogorytes fargeii is een vliesvleugelig insect uit de familie van de graafwespen (Crabronidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1837 door Shuckard.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)parasitoid

05DNA & barcoding31 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argogorytes fargeii has left across the world's sequence archives.

At a glance

DNA specimens31

BINs1

Marker genes1

eDNA detections30

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus28 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

296Gmostly conserved

625Gmostly conserved

AATTTTATACTTTATTCTAGCTATATGATCAGGAATAATTGGATCATCATTAAGAATGTTAATTCGAATAGAACTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.17%

Haplotypes7

BIN1

Most divergent pair0.76%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argogorytes mystaceussame genus10.8%Argogorytes hispanicussame genus12.3%Harpactus transienssame family13.7%Gorytes sulcifronssame family14.1%Harpactus mundussame family15.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 448 records

Wild obs. + sensor303

Museum / vouchered1 145

Range

Area of Occupancy AOO2 348 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 110≤1 km 63≤10 km 113>10 km 1

287 georeferenced · 16 without coordinates

Open the mapobservation + sensor303

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy35% within 1 km

≤100 m 123≤1 km 217≤10 km 611>10 km 7

958 georeferenced · 187 without coordinates

Open the institutions mapphysical evidence1 145

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	782
SLU Artdatabankenlocation not on record	93
Philadelphia, US	72
Tartu, EE	18
NMOKlocation not on record	17
Zürich, CH	16
Natural History Museum Rotterdamlocation not on record	15
Stockholm, SE	6
ZSMlocation not on record	6
Tallinn, EE	5
Metsähallituslocation not on record	5
Trondheim, NO	4
Gothenburg, SE	4
CBDClocation not on record	3
Tilburg, NL	3
Bavarian State Collection of Zoologylocation not on record	2
NCMGlocation not on record	2
Uniwersytet Łódzkilocation not on record	2
UGRlocation not on record	1
Rovaniemi, FI	1
Museu Nacional de História Natural e da Ciêncialocation not on record	1
Adam Mickiewicz University in Poznańlocation not on record	1

22 institutions · 1 059 of 1 145 vouchered records shown · 86 without an institution code

09Environmental DNA30 detections

Where the DNA of Argogorytes fargeii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found30

Studies independent surveys2

Countries6

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 30 detections have coordinates

Open the map6 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.8 °C 14.3–15.2

Seasonal swing summer↔winter18.4 °C

Max temp (day)19.2 °C 17.9–19.4

Min temp (night)8.70 °C 8.60–11.2

Precipitation58.9 mm/mo 58.9–74.4

Air humidity55.4 % 55.4–58.4

Moisture balance-76.6 mm/mo -76.6–-46.2

Vapour deficit751 Pa 691–753

Wind speed2.10 m/s 2.10–3.90

Cloud cover42.3 % 37.1–44.7

CHELSA 1981–2010, ~9 km grid, at location & month of 30 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Argogorytes fargeii

At a glance

Sources6 archives

Diet & foraging2

At a glance

Record type1 448 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 22 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 448 records