Argiope versicolor

(Doleschall, 1859) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Araneidae/Argiope

At a glance

Occurrence records275

Data sources9

Biological traits2

DNA specimens32

eDNA detections1

Sources9 archives

Databases and archives Argiope versicolor's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility275 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics32 specimens↗

World Spider Trait DBMasaryk University2 traits · 1 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF275 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD32 specimens

01Narrative

Argiope versicolor, the multi-coloured Saint Andrew's cross spider, is a species of orb-weaver spider found mostly in Southeast Asia, from China to Indonesia (Java).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPekár 2014a

Ecology1

Circadian activitydiurnal

Defence1

Primary defenceCrypsis

05DNA & barcoding32 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argiope versicolor has left across the world's sequence archives.

At a glance

DNA specimens32

BINs2

Marker genes2

eDNA detections1

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P373 bp consensus30 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 22 variable positions, in barcode order

1Avariable

2Gmostly conserved

3Tmostly conserved

4Avariable

10Gmostly conserved

19Avariable

25Avariable

34Amostly conserved

37Cvariable

70Avariable

100Tvariable

127Amostly conserved

130Gvariable

178Amostly conserved

205Cvariable

214Tmostly conserved

241Tmostly conserved

262Avariable

289Tvariable

328Amostly conserved

346Gvariable

367Amostly conserved

AGTAGAAATGGGAGTAGGAGCAGGATGAACTGTATACCCTCCTTTAGCTGGATTAGAAGGTCATGCTGGAAGATCTGTTGATTTTGCAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.5%

Haplotypes20

BIN1

Most divergent pair5.4%

AsiaOther

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type275 records

Wild obs. + sensor248

Museum / vouchered27

Range

Area of Occupancy AOO764 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy70% within 1 km

≤100 m 68≤1 km 55≤10 km 32>10 km 20

175 georeferenced · 73 without coordinates

Open the mapobservation + sensor248

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 27 records without

Open the institutions mapphysical evidence27

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	1

1 institutions · 1 of 27 vouchered records shown · 26 without an institution code

09Environmental DNA1 detections

Where the DNA of Argiope versicolor was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)