Argiope lobata

(Pallas, 1772) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Araneidae/Argiope

At a glance

Occurrence records7 390

Data sources9

Biological traits6

DNA specimens10

eDNA detections9

Sources9 archives

Databases and archives Argiope lobata's data was compiled from.

WikipediaWikimedia Foundation9 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility7 390 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

World Spider Trait DBMasaryk University6 traits · 8 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements8 literature sources6 traits

Occurrence & distributionGBIF7 390 records

Environmental DNA1 datasets · 5 countries9 detections

DNA & barcodingBOLD10 specimens

01Narrative

Argiope lobata is a species of spider belonging to the family Araneidae. It has a wide distribution encompassing the whole of Africa and stretching to southern Europe and into Asia. The male of this species is small (body length 6 mm) but the female is large and spectacular at up to 25 mm in length. The silver abdomen is marked with black and red spots and carries deep furrows and distinctive lobes around the edge. As with other spiders in this genus, the large web is usually decorated with prominent zig-zag stabilimenta. Ventral side of a female Argiope lobata

No narrative description available for this taxon yet.

02Traits & measurements

SourcesCraig et al. 2020Ministerial Decree 2001Nature and Landscape Protection Act 2002Order z1202-17Gajdoš & Svatoň 2001Gajdoš et al. 2014Zalevskiy & Bronskov 2017Pekár et al. 2012a

Predation1

Prey diversity6 mm

Ecology3

Legal protectionYes

Regional IUCN Red List categoryCritically Endangered (CR)

Regional non-IUCN Red List categoryInvaluable (DD)

Biomechanics2

Silk strength1 520 mm

Silk toughness196 mm

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argiope lobata has left across the world's sequence archives.

At a glance

DNA specimens10

BINs3

Marker genes1

eDNA detections9

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 64 variable positions, in barcode order

22Amostly conserved

43Amostly conserved

73Gmostly conserved

76Amostly conserved

82Gmostly conserved

88Amostly conserved

97Amostly conserved

100Amostly conserved

106Cmostly conserved

118Cvariable

139Tmostly conserved

166Gmostly conserved

181Amostly conserved

184Tmostly conserved

190Amostly conserved

193Tmostly conserved

196Gmostly conserved

199Gvariable

202Cvariable

205Tmostly conserved

206Tmostly conserved

208Gmostly conserved

235Cvariable

238Amostly conserved

253Gmostly conserved

256Amostly conserved

274Tmostly conserved

277Avariable

298Tmostly conserved

301Amostly conserved

316Amostly conserved

319Cvariable

331Gvariable

337Tmostly conserved

343Tmostly conserved

347Tmostly conserved

349Gmostly conserved

352Tmostly conserved

355Avariable

379Gvariable

397Tmostly conserved

433Gvariable

436Tmostly conserved

469Amostly conserved

478Amostly conserved

481Gmostly conserved

484Cmostly conserved

487Amostly conserved

508Tmostly conserved

514Cvariable

517Avariable

550Avariable

553Cvariable

581Tmostly conserved

583Gmostly conserved

586Tmostly conserved

592Amostly conserved

616Tmostly conserved

622Cvariable

625Gmostly conserved

628Tmostly conserved

631Gmostly conserved

637Cmostly conserved

649Amostly conserved

TACTTTATATTTGATTTTTGGAGCTTGAGCTGCTATAGTAGGAACAGCAATAAGAGTTTTAATTCGAATTGAGTTAGGACAGCCTGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.5%

Haplotypes8

BINs3

Most divergent pair7.4%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argiope australissame genus7.6%Neoscona subfuscasame family10.7%Argiope aurantiasame genus10.8%Neoscona cruciferasame family10.9%Poecilopachys australasiasame family11.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type7 390 records

Wild obs. + sensor7 248

Museum / vouchered139

Other3

Origin

Native88

Range

Area of Occupancy AOO19 056 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 2 759≤1 km 1 241≤10 km 765>10 km 235

5 000 georeferenced · 2 248 without coordinates

Open the mapobservation + sensor7 248

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy17% within 1 km

≤100 m 6≤1 km 3≤10 km 32>10 km 12

53 georeferenced · 86 without coordinates

Open the institutions mapphysical evidence139

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Frankfurt am Main	12
	7
Helsinki, FI	6
Royal Museum for Central Africalocation not on record	4
Ekaterinburg, RU	3
Cambridge, US	2
Bonn, DE	2
FETSlocation not on record	2
Tartu, EE	1
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	1
Chicago, US	1
Copenhagen, DK	1

12 institutions · 42 of 139 vouchered records shown · 82 without an institution code

09Environmental DNA9 detections

Where the DNA of Argiope lobata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map5 countries0

GenevriersNon coniferous deciduous forests

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.5 °C 14.6–24.6

Seasonal swing summer↔winter18.0 °C

Max temp (day)25.9 °C 19.8–29.7

Min temp (night)18.1 °C 8.40–21.1

Precipitation33.4 mm/mo 6.70–45.0

Air humidity53.9 % 51.2–56.5

Moisture balance-122 mm/mo

Vapour deficit1,176 Pa 890–1,522

Wind speed4.10 m/s

Cloud cover36.4 % 25.9–43.8

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Argiope lobata

At a glance

Sources9 archives

Predation1

Ecology3

Biomechanics2

At a glance

Record type7 390 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 12 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type7 390 records