Argiope dang

Jäger & Praxaysombath, 2009 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Araneidae/Argiope

At a glance

Occurrence records755

Data sources8

Biological traits28

DNA specimens14

eDNA detections15

Sources8 archives

Databases and archives Argiope dang's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility755 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

World Spider Trait DBMasaryk University28 traits · 1 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources28 traits

Occurrence & distributionGBIF755 records

Environmental DNA1 datasets · 4 countries15 detections

DNA & barcodingBOLD14 specimens

01Narrative

Argiope dang est une espèce d'araignées aranéomorphes de la famille des Araneidae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesJäger & Praxaysombath 2009

Morphometry28

Abdomen length♀8.75·♂2.1 mm

Body length♀13.6·♂4.05 mm

Cephalothorax length♀4.85·♂1.95 mm

Cephalothorax width♀4.15·♂1.85 mm

Femur I length♀8.4·♂2.8 mm

Femur II length♀8.4·♂2.8 mm

Femur III length♀5.7·♂1.8 mm

Femur IV length♀9.2·♂2.6 mm

Leg I length♀28.8·♂9.9 mm

Leg II length♀28.1·♂9.7 mm

Leg III length♀16.3·♂5.3 mm

Leg IV length♀26.6·♂7.8 mm

Metatarsus I length♀9.2·♂2.8 mm

Metatarsus II length♀9·♂2.7 mm

Metatarsus III length♀4.3·♂1.2 mm

Metatarsus IV length♀8.2·♂2.1 mm

Patella I length♀2.4·♂0.9 mm

Patella II length♀2.3·♂0.9 mm

Patella III length♀1.6·♂0.6 mm

Patella IV length♀2.2·♂0.7 mm

Tarsus I length♀1.8·♂1.1 mm

Tarsus II length♀1.7·♂1 mm

Tarsus III length♀1.3·♂0.7 mm

Tarsus IV length♀1.4·♂0.8 mm

Tibia I length♀7·♂2.3 mm

Tibia II length♀6.7·♂2.3 mm

Tibia III length♀3.4·♂1 mm

Tibia IV length♀5.6·♂1.6 mm

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argiope dang has left across the world's sequence archives.

At a glance

DNA specimens14

BINs1

Marker genes2

eDNA detections15

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P363 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

1Amostly conserved

2Gmostly conserved

3Tmostly conserved

4Tvariable

10Gmostly conserved

40Tvariable

94Tmostly conserved

118Cmostly conserved

175Amostly conserved

241Gmostly conserved

313Tmostly conserved

331Cmostly conserved

358Gmostly conserved

AGTTGAAATGGGAGTAGGGGCAGGATGAACTGTATATCCTCCTTTAGCAGGATTAGAAGGACATGCTGGGAGATCTGTTGATTTTGCAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes11

BIN1

Most divergent pair2.2%

Asia

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type755 records

Wild obs. + sensor747

Museum / vouchered8

Range

Area of Occupancy AOO1 212 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 257≤1 km 182≤10 km 45>10 km 46

530 georeferenced · 217 without coordinates

Open the mapobservation + sensor747

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 8 records without

Open the institutions mapphysical evidence8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Frankfurt am Main	8

1 institutions · 8 of 8 vouchered records shown

09Environmental DNA15 detections

Where the DNA of Argiope dang was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.9 °C 25.9–27.7

Seasonal swing summer↔winter0.9 °C

Max temp (day)30.4 °C 28.6–31.7

Min temp (night)22.0 °C 22.0–25.3

Precipitation309 mm/mo 136–309

Air humidity68.8 % 60.9–68.8

Moisture balance162 mm/mo -24.4–162

Vapour deficit1,043 Pa 1,043–1,475

Wind speed0.7 m/s 0.7–2.80

Cloud cover49.9 % 49.9–61.6

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)