Argentostiria koebelei

Riley, 1893 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Argentostiria

At a glance

Occurrence records203

Data sources6

Biological traits0

DNA specimens7

eDNA detections5

Sources6 archives

Databases and archives Argentostiria koebelei's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility203 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF203 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD7 specimens

01Narrative

Argentostiria is a monotypic moth genus of the family Noctuidae erected by Robert W. Poole in 1995. Its only species, Argentostiria koebelei, was first described by Riley in 1893. It is found in the Mojave Desert of the United States.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argentostiria koebelei has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

eDNA detections5

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.10%

Haplotypes1

BIN1

Where individuals differ — all 2 variable positions, in barcode order

139Tmostly conserved

652Tmostly conserved

TACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTATTAATTCGAGCTGAATTAGGTAATCCTGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Plagiomimicus pyralinasame family4.3%Plagiomimicus spumosumsame family4.6%Stiria blanchardisame family4.7%Rhiza minutasame family4.7%Stiria consuelasame family5.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type203 records

Wild obs. + sensor160

Museum / vouchered43

Range

Area of Occupancy AOO436 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 76≤1 km 11≤10 km 8>10 km 23

118 georeferenced · 42 without coordinates

Open the mapobservation + sensor160

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy54% within 1 km

≤100 m 13≤1 km 2≤10 km 10>10 km 3

28 georeferenced · 15 without coordinates

Open the institutions mapphysical evidence43

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Francisco, US	13
New Haven, US	11
University of Alberta Museums (UAM)location not on record	8
St. Paul, US	4
ASUlocation not on record	3
San Diego, US	1
US	1

7 institutions · 41 of 43 vouchered records shown · 2 without an institution code

09Environmental DNA5 detections

Where the DNA of Argentostiria koebelei was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.0 °C 18.5–23.4

Seasonal swing summer↔winter20.5 °C

Max temp (day)27.8 °C 25.5–30.0

Min temp (night)13.9 °C 11.3–16.4

Precipitation7.20 mm/mo 2.70–11.7

Air humidity45.0 % 42.7–47.3

Moisture balance-167 mm/mo -168–-165

Vapour deficit1,401 Pa 1,134–1,668

Wind speed2.90 m/s 2.50–3.20

Cloud cover24.9 % 15.5–34.3

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)