Argentina australiae

Cohen, 1958 · species

image placeholder — illustration coming later

Animalia/Chordata/Osmeriformes/Argentinidae/Argentina

At a glance

Occurrence records509

Data sources7

Biological traits6

DNA specimens7

eDNA detections6

Sources7 archives

Databases and archives Argentina australiae's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility255 records↗

OBISOcean Biodiversity Information System254 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS509 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD7 specimens

01Narrative

Argentina australiae is een straalvinnige vissensoort uit de familie van zilversmelten (Argentinidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1958 door Cohen.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length13 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthopelagic

Other traits3

Depth max400 m

Depth min30 m

Vulnerability10

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argentina australiae has left across the world's sequence archives.

At a glance

DNA specimens7

BINs2

Marker genes1

eDNA detections6

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 83% of positions are identical in every specimen.

Diversity (π)6.1%

Haplotypes1

BINs2

Where individuals differ — all 113 variable positions, in barcode order

15Gmostly conserved

27Cmostly conserved

30Amostly conserved

51Cmostly conserved

52Cmostly conserved

60Gvariable

61Tmostly conserved

69Amostly conserved

72Cmostly conserved

78Cmostly conserved

87Cmostly conserved

93Cmostly conserved

96Cmostly conserved

97Cmostly conserved

99Avariable

105Cmostly conserved

108Tmostly conserved

114Cmostly conserved

117Cmostly conserved

120Cmostly conserved

123Amostly conserved

141Cmostly conserved

147Cmostly conserved

150Amostly conserved

174Cmostly conserved

177Gmostly conserved

186Tmostly conserved

198Amostly conserved

201Cmostly conserved

207Tmostly conserved

208Cmostly conserved

210Tmostly conserved

213Amostly conserved

216Cmostly conserved

225Cmostly conserved

234Gmostly conserved

264Gmostly conserved

267Amostly conserved

270Tmostly conserved

273Cmostly conserved

279Amostly conserved

285Tmostly conserved

288Tmostly conserved

292Tmostly conserved

294Gmostly conserved

297Cmostly conserved

300Gmostly conserved

303Tmostly conserved

306Amostly conserved

309Tmostly conserved

312Avariable

315Tmostly conserved

321Tmostly conserved

324Amostly conserved

327Amostly conserved

330Tmostly conserved

336Cvariable

339Amostly conserved

348Tvariable

357Cmostly conserved

363Cmostly conserved

369Cmostly conserved

372Amostly conserved

375Amostly conserved

388Tmostly conserved

390Gmostly conserved

393Cmostly conserved

396Tmostly conserved

399Cmostly conserved

405Tmostly conserved

414Cmostly conserved

417Cmostly conserved

420Tmostly conserved

432Tmostly conserved

435Gmostly conserved

447Tmostly conserved

460Amostly conserved

462Tmostly conserved

465Tmostly conserved

468Avariable

471Amostly conserved

474Tmostly conserved

477Cmostly conserved

486Cmostly conserved

498Tmostly conserved

510Tmostly conserved

513Amostly conserved

519Cmostly conserved

528Tmostly conserved

531Gmostly conserved

534Tmostly conserved

537Cmostly conserved

540Amostly conserved

543Cmostly conserved

549Tmostly conserved

561Amostly conserved

570Avariable

576Cmostly conserved

579Amostly conserved

582Cmostly conserved

585Gmostly conserved

591Cmostly conserved

600Amostly conserved

606Tmostly conserved

609Amostly conserved

627Amostly conserved

630Cmostly conserved

633Tmostly conserved

639Gmostly conserved

642Cmostly conserved

645Avariable

648Tmostly conserved

651Gmostly conserved

GGCACCCTCTACCTGGTGTTTGGTGCCTGAGCCGGAATGGTCGGCACAGCCCTAAGCCTGTTAATTCGAGCCGAGCTCAGCCAGCCCGGA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argentina elongatasame genus14.9%Prognichthys sealeisame order15.5%Argentina euchussame genus15.8%Argentina sphyraenasame genus16.3%Argentina striatasame genus16.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type509 records

Wild obs. + sensor234

Museum / vouchered275

Range

Area of Occupancy AOO800 km²

Depth

0–200 m sunlit91

200–1000 m twilight41

1–4 km midnight0

>4 km abyssal0

median 148.2 m · max 420 m · 132 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 6≤1 km 188≤10 km 40

234 georeferenced

Open the mapobservation + sensor234

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤100 m 21≤1 km 89≤10 km 59>10 km 13

182 georeferenced · 93 without coordinates

Open the institutions mapphysical evidence275

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Australian National Fish Collectionlocation not on record	52
Sydney, AU	46
Museums Victorialocation not on record	26
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	5
Tasmanian Museum & Art Gallerylocation not on record	3
QVMAGlocation not on record	3
Natick, US	2
Museums Victoria, Australialocation not on record	1

8 institutions · 138 of 275 vouchered records shown

09Environmental DNA6 detections

Where the DNA of Argentina australiae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.6 °C 11.5–18.8

Seasonal swing summer↔winter5.50 °C

Max temp (day)16.0 °C 12.4–19.9

Min temp (night)13.7 °C 9.90–17.6

Precipitation46.7 mm/mo 26.2–73.5

Air humidity58.6 % 57.1–61.4

Vapour deficit679 Pa 558–890

Cloud cover24.1 % 21.9–38.9

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)