Argemone glauca — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Papaveraceae/Argemone

At a glance

Occurrence records401

Data sources5

Biological traits20

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Argemone glauca's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility401 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources20 traits

Occurrence & distributionGBIF401 records

DNA & barcodingNCBIsequences

01Narrative

Argemone albiflora Pope – gatunek rośliny z rodziny makowatych. Występuje endemicznie na Hawajach.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology8

Fruit length max60 mm

Fruit length min30 mm

Leaf length max210 mm

Leaf length min80 mm

Leaf width max110 mm

Leaf width min60 mm

Plant height max1.5 m

Plant height min0.7 m

Life cycle & reproduction3

Dehiscencedehiscent

Life formannual

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit typecapsule

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argemone glauca has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSAF057651.1 ↗253 bp

ACGT

CATTGTCGAAACCTGCCTAGCAGAACGACCCGTGAACACGTGAAGCCAAGTTCAGCGGGACGGCAAGGGGAGTGATCCCATTGCCTTACC …

Argemone glauca internal transcribed spacer 1, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS1

fungal barcode

08Occurrence & distribution

Record type401 records

Wild obs. + sensor357

Museum / vouchered44

Range

Area of Occupancy AOO536 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 206≤1 km 38≤10 km 17>10 km 28

289 georeferenced · 68 without coordinates

Open the mapobservation + sensor357

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy15% within 1 km

≤1 km 2≤10 km 8>10 km 3

13 georeferenced · 31 without coordinates

Open the institutions mapphysical evidence44

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BISHlocation not on record	22
Honolulu, US	12
Vancouver, CA	2
University of Stellenboschlocation not on record	2
Auckland, NZ	2
Bronx, US	1
Fullerton, US	1
St. Paul, US	1
San Diego, US	1

9 institutions · 44 of 44 vouchered records shown