Argemone corymbosa — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Papaveraceae/Argemone

At a glance

Occurrence records247

Data sources8

Biological traits10

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Argemone corymbosa's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility247 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF247 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 56

01Narrative

Argemone corymbosa, the Mojave prickly poppy, is a flowering plant in the family Papaveraceae native to the eastern Mojave Desert of the southwestern United States. It especially common around Cima, California and the nearby community of Kelso, California. The plant grows in sandy places and on dry slopes, and is very similar to desert prickly poppy.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formperennial

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argemone corymbosa has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

The DNA barcodea real sequence read deposited for this species

ITSAF057661.1 ↗253 bp

ACGT

CATTGTCGAAACCTGCCTAGCAGAACGACCCGTGAACACGTGAAGCCAAGTTCAGCGGGACGGCAAGGGGAGTGATCCCATTGCCTTACC …

Argemone corymbosa subsp. corymbosa internal transcribed spacer 1, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Argemone corymbosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 56 n = 28

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 561×CCDB · eflora

CCDB · eflora

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type247 records

Wild obs. + sensor118

Museum / vouchered129

Origin

Native23

Range

Area of Occupancy AOO656 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 78≤1 km 8≤10 km 6>10 km 7

99 georeferenced · 19 without coordinates

Open the mapobservation + sensor118

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 1≤1 km 27≤10 km 28>10 km 4

60 georeferenced · 69 without coordinates

Open the institutions mapphysical evidence129

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions28 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Claremont, US	26
Riverside, US	17
Flagstaff, US	17
Davis, US	6
Fullerton, US	6
Long Beach, US	5
Canadian Department of Agriculturelocation not on record	5
Boise, US	3
San Jose, US	3
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	3
ASUlocation not on record	3
College Park, US	3
Los Angeles, US	2
Severin-McDaniel Insect Collectionlocation not on record	2
Santa Barbara, US	2
Bronx, US	2
San Diego, US	2
Arcata, US	2
Logan, US	2
San Francisco, US	1
EL PASO, US	1
Tampa, US	1
Orem, US	1
Albuquerque, US	1
Eastern Nevada Landscape Coalitionlocation not on record	1
Irvine, US	1
Phoenix, US	1
University of Stellenboschlocation not on record	1
Weber State Universitylocation not on record	1
Provo, US	1
Northridge, US	1
San Luis Obispo, US	1
Mexico City, MX	1
Turlock, US	1
Pullman, US	1

35 institutions · 127 of 129 vouchered records shown · 2 without an institution code