Argemone albiflora

Hornem. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Papaveraceae/Argemone

At a glance

Occurrence records2 627

Data sources12

Biological traits14

DNA specimens3

eDNA detections3

Sources12 archives

Databases and archives Argemone albiflora's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 627 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Chemical compositionLOTUS · NPASS14 compounds

Occurrence & distributionGBIF2 627 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 28

01Narrative

Argemone albiflora, the white prickly poppy, also known as the bluestem prickly poppy or the Texas prickly poppy, is a small erect plant with a decorative white flower with a yellow latex. It is deeply rooted with yellow or red stamens. The plant is known for the sharp prickles on its stem and leaves. The sepals fall off as the flower of this plant grows bigger. It grows in the arid regions of the southern Midwest along roadsides and disturbed pieces of land. Native Americans have long revered this plant for its medicinal and other uses.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass3.6 mg

Seed mass max4.6 mg

Seed mass min2.6 mg

Life cycle & reproduction3

Life formannual or biennial

Life spanannual/biennial

⚠ sources differ — TRY: annual/biennial · GIFT: annual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

03Chemical composition14 compounds

Compounds documented for Argemone albiflora across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Isoquinoline alkaloids8

Isoquinoline alkaloids $ Protopine alkaloids4

Isoquinoline alkaloids $ Tetrahydroisoquinoline alkaloids3

Isoquinoline alkaloids $ Protoberberine alkaloids3

Aporphine alkaloids2

Documented compounds14 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Reticuline	present	LOTUS
(13Ar)-3,10-Dimethoxy-6,8,13,13A-Tetrahydro-5H-Isoquinolino(2,1-B)Isoquinoline-2,9-Diol	present	LOTUS
(1R)-1-(1,3-benzodioxol-5-ylmethyl)-6-methoxy-2-methyl-3,4-dihydro-1H-isoquinolin-7-ol	present	LOTUS
(6aR,12aR)-2,9-dimethoxy-5,6,6a,7,12,12a-hexahydrobenzo[b]phenanthridine-3,8-diol	present	LOTUS
(S)-scoulerine	present	LOTUS
16,17-Dimethoxy-5,7-dioxa-12-azapentacyclo[11.8.0.02,10.04,8.015,20]henicosa-1(13),2,4(8),9,14,16,18,20-octaen-14-ol	present	LOTUS
5,7,8,15-Tetrahydro-4-hydroxy-3-methoxy-6-methyl[1,3]benzodioxolo[5,6-e][2]benzazecin-14(6H)-one	present	LOTUS
alpha-Allocryptopine	present	LOTUS
Berberine	present	LOTUS
JUQBPFGIFICIIN-UHFFFAOYSA-N	present	NPASS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argemone albiflora has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences10

eDNA detections3

Countries2

The DNA barcodea real sequence read deposited for this species

ITSAF057670.1 ↗252 bpUSA

ACGT

CATTGTCGAAACCTGCCTAGCAGAACGACCCGTGAACACGTGAAGCCAAGTTCAGCGGGACGGCAAGGGGAGTGATCCCGTTGCCTTACC …

Argemone albiflora internal transcribed spacer 1, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★ITS6★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Argemone albiflora carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidydiploid inferred

Chromosome records28–282n range28median28mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 282×CCDB · eflora

CCDB · eflora

n 144×CCDB · book-ipcn75-78 · CCDB · book-ipcn73-74

CCDB · book-ipcn75-78 — Malik 1974

CCDB · book-ipcn75-78 — Malik & Mary 1976

CCDB · book-ipcn73-74 — MALIK, C.P., & I.S. GROVER. 1973. The genus Argemone I. Cytogenetic relationships between diploid species. Genetica 44: 55-70.

CCDB · book-ipcn73-74 — MALIK, C.P., & I.S. GROVER. 1974. The genus Argemone. I. Cytogenet relationships between diploid species. Genetica 44: 55-70.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type2 627 records

Wild obs. + sensor2 369

Museum / vouchered258

Origin

Native1

Range

Area of Occupancy AOO5 736 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 1 393≤1 km 255≤10 km 109>10 km 122

1 879 georeferenced · 490 without coordinates

Open the mapobservation + sensor2 369

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy35% within 1 km

≤100 m 7≤1 km 39≤10 km 67>10 km 20

133 georeferenced · 125 without coordinates

Open the institutions mapphysical evidence258

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions29 of 41 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Austin, US	56
BAYLUlocation not on record	27
Fort Worth, US	18
Tampa, US	18
Jena Microbial Resource Collectionlocation not on record	17
Chapel Hill, US	13
EL PASO, US	11
San Angelo, US	10
Bronx, US	8
Lubbock, US	7
Giardini Botanici Hanburylocation not on record	5
Tuscaloosa, US	5
Claremont, US	4
Albuquerque, US	4
Bloomington, US	4
Saint Louis, US	4
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	4
Riverside, US	4
Miami, US	3
Columbia, US	3
Durango, MX	3
Emporia, US	2
Ann Arbor, US	2
AUAlocation not on record	2
CASlocation not on record	2
Due West, US	1
Denton, US	1
Texas Lutheran Universitylocation not on record	1
Coastal Carolina Universitylocation not on record	1
Kensington, AU	1
Mount Pleasant, US	1
South Kensington, GB	1
GAlocation not on record	1
Chongqing Museumlocation not on record	1
Chicago, US	1
Austin, US	1
Tall Timbers Research Stationlocation not on record	1
Millersville, US	1
ASUlocation not on record	1
Clemson, US	1
Jackson, US	1

41 institutions · 252 of 258 vouchered records shown · 3 without an institution code

09Environmental DNA3 detections

Where the DNA of Argemone albiflora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.5 °C 12.5–12.5

Seasonal swing summer↔winter27.0 °C

Max temp (day)18.4 °C

Min temp (night)8.20 °C

Precipitation79.6 mm/mo

Air humidity57.3 %

Moisture balance-38.4 mm/mo

Vapour deficit733 Pa

Wind speed5.80 m/s

Cloud cover36.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Argemone albiflora

At a glance

Sources12 archives

Size & morphology3

Life cycle & reproduction3

Diet & foraging1

Habitat & environment6

Physiology & chemistry1

Compound class profile5 classes

Documented compounds14 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 627 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions29 of 41 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 627 records