Argema mittrei

Guérin-Méneville, 1846 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Saturniidae/Argema

At a glance

Occurrence records195

Data sources7

Biological traits0

DNA specimens9

eDNA detections9

Sources7 archives

Databases and archives Argema mittrei's data was compiled from.

WikipediaWikimedia Foundation9 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility195 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF195 records

Environmental DNA1 datasets · 1 countries9 detections

DNA & barcodingBOLD9 specimens

01Narrative

Weibchen am Kokon im Réserve Peyrieras Argema mittrei, Männchen Der Kometenfalter (Argema mittrei) (Synonym: Actias mittrei), auch bekannt als Kometenmotte oder Kometenschmetterling, ist ein endemisch auf Madagaskar vorkommender Schmetterling aus der Familie der Pfauenspinner (Saturniidae).

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argema mittrei has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes2

eDNA detections9

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 14 variable positions, in barcode order

100Amostly conserved

268Tmostly conserved

282Tmostly conserved

295Tmostly conserved

352Amostly conserved

385Tmostly conserved

424Gmostly conserved

451Cvariable

506Gmostly conserved

508Cmostly conserved

547Cmostly conserved

568Cmostly conserved

619Tmostly conserved

628Amostly conserved

AACTTTATACTTTATTTTTGGAATTTGATCAGGATTAGTAGGTTCATCATTAAGTTTATTAATTCGAACAGAATTAGGAAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.62%

Haplotypes5

BIN1

Most divergent pair1.5%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Saturnia fukudaisame family11.7%Schausiella polybiasame family12.2%Pseudaphelia flavomarginatasame family12.2%Selenophanes josephussame order12.2%Antipterna ptychomochlasame order13.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type195 records

Wild obs. + sensor179

Museum / vouchered16

Range

Area of Occupancy AOO260 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 73≤1 km 35≤10 km 23>10 km 13

144 georeferenced · 35 without coordinates

Open the mapobservation + sensor179

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤1 km 2≤10 km 1>10 km 2

5 georeferenced · 11 without coordinates

Open the institutions mapphysical evidence16

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chicago, US	4
Auckland, NZ	3
Paris, FR	2
Natural History Museum of Utahlocation not on record	2
New Haven, US	2
Cornell University Insect Collectionlocation not on record	1

6 institutions · 14 of 16 vouchered records shown · 2 without an institution code

09Environmental DNA9 detections

Where the DNA of Argema mittrei was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map1 country0

CVB sign

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.5 °C 12.8–23.2

Seasonal swing summer↔winter6.20 °C

Max temp (day)20.8 °C 18.1–26.8

Min temp (night)10.3 °C 7.60–19.5

Precipitation20.1 mm/mo 4.10–411

Air humidity58.8 % 53.9–70.6

Moisture balance-72.6 mm/mo -90.4–268

Vapour deficit732 Pa 655–832

Wind speed3.00 m/s 1.20–3.70

Cloud cover12.7 % 7.30–47.6

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)