Argeia pugettensis

Dana, 1853 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Isopoda/Bopyridae/Argeia

At a glance

Occurrence records245

Data sources8

Biological traits1

DNA specimens9

eDNA detections8

Sources8 archives

Databases and archives Argeia pugettensis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility151 records↗

OBISOcean Biodiversity Information System94 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF · OBIS245 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD9 specimens

01Narrative

Argeia pugettensis is een pissebed uit de familie Bopyridae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1853 door Dana.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment1

Habitat saltwateryes

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argeia pugettensis has left across the world's sequence archives.

At a glance

DNA specimens9

BINs2

Marker genes3

eDNA detections8

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 85% of positions are identical in every specimen.

Where individuals differ — all 101 variable positions, in barcode order

1Avariable

5Tmostly conserved

7Amostly conserved

13Cmostly conserved

22Tmostly conserved

28Amostly conserved

31Tmostly conserved

34Gmostly conserved

52Gmostly conserved

56Amostly conserved

58Tmostly conserved

67Cmostly conserved

82Tmostly conserved

85Tmostly conserved

103Amostly conserved

121Cmostly conserved

124Cmostly conserved

127Avariable

130Tmostly conserved

133Tmostly conserved

166Gmostly conserved

172Tmostly conserved

181Amostly conserved

184Tmostly conserved

199Tmostly conserved

208Gmostly conserved

211Amostly conserved

212Tmostly conserved

217Gmostly conserved

220Tmostly conserved

226Cvariable

241Gmostly conserved

247Tmostly conserved

251Cmostly conserved

253Amostly conserved

259Tmostly conserved

265Tmostly conserved

268Cmostly conserved

271Tmostly conserved

280Cmostly conserved

283Amostly conserved

286Tvariable

289Gmostly conserved

292Tmostly conserved

298Amostly conserved

299Gmostly conserved

307Gmostly conserved

313Gmostly conserved

319Amostly conserved

331Amostly conserved

337Cmostly conserved

340Cmostly conserved

343Cvariable

346Cvariable

349Amostly conserved

352Amostly conserved

367Tmostly conserved

373Cmostly conserved

376Amostly conserved

385Tmostly conserved

406Tmostly conserved

415Gmostly conserved

418Cmostly conserved

421Cmostly conserved

433Amostly conserved

451Tmostly conserved

463Cmostly conserved

466Tmostly conserved

469Amostly conserved

472Tmostly conserved

473Gmostly conserved

479Amostly conserved

487Tmostly conserved

490Gmostly conserved

499Tmostly conserved

505Tmostly conserved

508Cmostly conserved

511Gmostly conserved

517Gmostly conserved

535Tmostly conserved

544Tmostly conserved

547Tmostly conserved

548Cmostly conserved

550Avariable

556Gmostly conserved

562Amostly conserved

565Tmostly conserved

568Cmostly conserved

574Tmostly conserved

578Cmostly conserved

592Cmostly conserved

598Amostly conserved

601Tmostly conserved

607Cmostly conserved

610Cmostly conserved

622Amostly conserved

625Gmostly conserved

634Tmostly conserved

646Cmostly conserved

652Cmostly conserved

655Avariable

AATTTTATATTTCCTATTTGGTGCTTGAGCTGGGGGAGTTGGCACTTCTATGAGGATTCTTATTCGCACTGAATTAGCCAGTTGTGGCAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)5.4%

Haplotypes3

BINs2

Most divergent pair14.6%

N.AmericaAsia

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-3P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type245 records

Wild obs. + sensor18

Museum / vouchered227

Range

Area of Occupancy AOO640 km²

Depth

0–200 m sunlit60

200–1000 m twilight1

1–4 km midnight0

>4 km abyssal0

median 49 m · max 249 m · 61 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 7≤1 km 5

12 georeferenced · 6 without coordinates

Open the mapobservation + sensor18

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤1 km 4≤10 km 5>10 km 5

14 georeferenced · 213 without coordinates

Open the institutions mapphysical evidence227

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	106
CIECRlocation not on record	11
Edmonton, CA	5
Victoria, CA	4
CASlocation not on record	4
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3
Florida Museum of Natural Historylocation not on record	1
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
Toronto, CA	1

9 institutions · 136 of 227 vouchered records shown · 2 without an institution code

09Environmental DNA8 detections

Where the DNA of Argeia pugettensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

cobble gravel beach

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.9 °C 6.80–17.9

Seasonal swing summer↔winter12.8 °C

Max temp (day)18.3 °C 8.10–20.6

Min temp (night)13.7 °C 5.20–15.9

Precipitation87.7 mm/mo 45.9–216

Air humidity61.7 % 58.1–67.3

Vapour deficit673 Pa 349–852

Cloud cover37.6 % 32.8–47.9

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)