Arge humeralis

(Beauvois) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Argidae/Arge

At a glance

Occurrence records506

Data sources6

Biological traits0

DNA specimens7

eDNA detections3

Sources6 archives

Databases and archives Arge humeralis's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility506 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF506 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD7 specimens

01Narrative

Arge humeralis, the poison ivy sawfly, is a species of argid sawfly in the family Argidae. Poison ivy sawfly, Arge humeralis .Larvae feed on poison ivy, Toxicodendron radicans.Illinois Wildflowers

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arge humeralis has left across the world's sequence archives.

At a glance

DNA specimens7

BINs2

Marker genes1

eDNA detections3

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P592 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Diversity (π)3.1%

Haplotypes2

BINs2

Most divergent pair4.7%

Where individuals differ — all 32 variable positions, in barcode order

3Cvariable

18Avariable

34Gvariable

39Avariable

78Tvariable

87Cvariable

90Cvariable

105Tvariable

135Gmostly conserved

177Cvariable

186Cmostly conserved

214Tmostly conserved

222Cmostly conserved

225Cmostly conserved

242Cvariable

254Tmostly conserved

261Tvariable

282Gmostly conserved

286Gmostly conserved

294Amostly conserved

308Avariable

313Avariable

363Tmostly conserved

366Amostly conserved

409Amostly conserved

429Gmostly conserved

505Gmostly conserved

516Tmostly conserved

567Tmostly conserved

570Tmostly conserved

576Avariable

588Tvariable

TTCAGAATAATTATTCGAACAGAATTATTAACTGCAGGATCATTAATTAAAGATGATCAAATTTATAATACAATTGTTACTTCTCACGCC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arge cyanocroceasame genus11.8%Arge rusticasame genus12.0%Arge similissame genus12.3%Arge annulatasame genus12.3%Arge nigripessame genus12.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type506 records

Wild obs. + sensor227

Museum / vouchered279

Range

Area of Occupancy AOO1 308 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 91≤1 km 59≤10 km 7>10 km 24

181 georeferenced · 46 without coordinates

Open the mapobservation + sensor227

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy21% within 1 km

≤100 m 1≤1 km 22≤10 km 87

110 georeferenced · 169 without coordinates

Open the institutions mapphysical evidence279

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	113
OSUClocation not on record	74
University of Central Floridalocation not on record	46
Cleveland Museum of Natural History, OH (CLEV)location not on record	18
University of Guelphlocation not on record	14
Chicago, US	10
WIlocation not on record	1
Lake Placid, US	1
US	1

9 institutions · 278 of 279 vouchered records shown · 1 without an institution code

09Environmental DNA3 detections

Where the DNA of Arge humeralis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)