Arenophryne rotunda

Tyler, 1976 · species

image placeholder — illustration coming later

Animalia/Chordata/Amphibia/Anura/Myobatrachidae/Arenophryne

At a glance

Occurrence records93

Data sources8

Biological traits13

DNA specimens18

eDNA detections0

Sources8 archives

Databases and archives Arenophryne rotunda's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility93 records↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

Amphibian Species of the WorldAMNHamphibian catalog↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources13 traits

Occurrence & distributionGBIF93 records

DNA & barcodingBOLD18 specimens

Genome at a glanceGoaT2n = 24

01Narrative

The northern sandhill frog (Arenophryne rotunda) is a small, fossorial frog native to a small region of the Western Australian coast. It was formerly considered the sole species within the genus Arenophryne until the first decade of the 2000s, when a new species of frog called the southern sandhill frog was discovered about 100 kilometres from Geraldton, Western Australia in Kalbarri National Park and given the scientific name Arenophryne xiphorhyncha.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmphiBIO

Size & morphology2

Body mass8 g

SVL3.3 cm

Life cycle & reproduction3

Litter size max11

Litter size min4

Reproductive output1 /year

Diet & foraging1

Arthropodsyes

Habitat & environment3

Habitat aquaticyes

Habitat fossorialyes

Habitat terrestrialyes

Other traits4

Activity nocturnalyes

Offspring size max6 mm

Offspring size min5 mm

Repro directyes

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arenophryne rotunda has left across the world's sequence archives.

At a glance

DNA specimens18

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus18 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.33%

Haplotypes2

BIN1

Most divergent pair0.30%

Where individuals differ — all 5 variable positions, in barcode order

91Gvariable

97Cmostly conserved

127Tvariable

502Avariable

544Gvariable

AACCCTTTATCTCATTTTTGGGGCCTGAGCAGGCATAATCGGCACTGCCCTAAGCCTCTTAATCCGAGCTGAACTTAGCCAACCCGGGTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arenophryne xiphorhynchasame genus7.4%Myobatrachus gouldiisame family13.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Arenophryne rotunda carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Chromosome records24–242n range24median24mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 242×GoaT · Animal Chromosome Counts Database · GoaT · Amphibian Karyotype Database

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Amphibian Karyotype Database — ↗

08Occurrence & distribution

Record type93 records

Wild obs. + sensor5

Museum / vouchered88

Range

Area of Occupancy AOO92 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 4

4 georeferenced · 1 without coordinates

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 87 without coordinates

Open the institutions mapphysical evidence88

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Western Australian Museumlocation not on record	62
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	14
Natick, US	2
Sydney, AU	1

4 institutions · 79 of 88 vouchered records shown · 9 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)