Arenicolides ecaudata — The Life Data

Animalia/Annelida/Polychaeta/Arenicolidae/Arenicolides

At a glance

Occurrence records502

Data sources6

Biological traits2

DNA specimens8

eDNA detections0

Sources6 archives

Databases and archives Arenicolides ecaudata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility364 records↗

OBISOcean Biodiversity Information System138 records↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS502 records

DNA & barcodingBOLD8 specimens

01Narrative

Arenicolides ecaudata is een borstelworm uit de familie Arenicolidae. De wetenschappelijke naam van de soort werd in 1835 gepubliceerd door Johnston.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arenicolides ecaudata has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes2

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

TACAATATATTTTATTTTTGGTATTTGAGCCGGTTTATTAGGTACATCAATAAGTTTACTTATCCGAACTGAACTAGGTCAACCTGGCTC …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

COI-5P16S

animal barcoderibosomal

08Occurrence & distribution

Record type502 records

Wild obs. + sensor380

Museum / vouchered94

Other28

Range

Area of Occupancy AOO676 km²

Depth

0–200 m sunlit65

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 22 m · max 112 m · 65 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 376

376 georeferenced · 4 without coordinates

Open the mapobservation + sensor380

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy72% within 1 km

≤100 m 14≤1 km 7≤10 km 8

29 georeferenced · 65 without coordinates

Open the institutions mapphysical evidence94

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NTNU-VMlocation not on record	13
Bergen, NO	13
DASSHlocation not on record	5
South Kensington, GB	2
University Museum of Bergen, Natural History Collectionslocation not on record	1
Stockholm, SE	1
486location not on record	1
Natural History Museum, Londonlocation not on record	1
Institut Francais pour l'Etude de la Merlocation not on record	1
PNHSlocation not on record	1

10 institutions · 39 of 94 vouchered records shown · 3 without an institution code