Arenicola loveni

Kinberg, 1866 · species

image placeholder — illustration coming later

Animalia/Annelida/Polychaeta/Arenicolidae/Arenicola

At a glance

Occurrence records80

Data sources7

Biological traits0

DNA specimens29

eDNA detections29

Sources7 archives

Databases and archives Arenicola loveni's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility78 records↗

OBISOcean Biodiversity Information System2 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI29 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics29 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF · OBIS80 records

Environmental DNA1 datasets · 0 countries29 detections

DNA & barcodingBOLD29 specimens

01Narrative

Arenicola loveni is een borstelworm uit de familie Arenicolidae. De wetenschappelijke naam van de soort werd in 1866 gepubliceerd door J.G.H. Kinberg.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding29 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arenicola loveni has left across the world's sequence archives.

At a glance

DNA specimens29

BINs4

Marker genes1

eDNA detections29

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P631 bp consensus29 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 27 variable positions, in barcode order

1Amostly conserved

10Avariable

28Gmostly conserved

55Gvariable

67Tvariable

79Cmostly conserved

223Avariable

224Amostly conserved

235Cmostly conserved

255Tmostly conserved

261Tmostly conserved

286Avariable

292Cvariable

306Tmostly conserved

343Gvariable

364Tmostly conserved

370Gvariable

381Cmostly conserved

424Amostly conserved

442Tmostly conserved

469Tvariable

475Avariable

520Cvariable

541Avariable

589Cmostly conserved

602Tmostly conserved

619Amostly conserved

AGCAGGCTTACTAGGAACATCTATAAGGCTATTAATTCGTACAGAATTAGGTCAGCCCGGAGCATTTCTAGGAAGAGACCAACTCTACAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.8%

Haplotypes29

BINs4

Most divergent pair8.1%

Africa

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type80 records

Wild obs. + sensor14

Museum / vouchered66

Range

Area of Occupancy AOO112 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 3≤1 km 2

5 georeferenced · 9 without coordinates

Open the mapobservation + sensor14

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 66 records without

Open the institutions mapphysical evidence66

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Montgomery, US	1
Stockholm, SE	1

2 institutions · 2 of 66 vouchered records shown · 63 without an institution code

09Environmental DNA29 detections

Where the DNA of Arenicola loveni was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found29

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 29 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)