Arenicola defodiens

Cadman & Nelson-Smith, 1993 · species

image placeholder — illustration coming later

Animalia/Annelida/Polychaeta/Arenicolidae/Arenicola

At a glance

Occurrence records932

Data sources7

Biological traits2

DNA specimens6

eDNA detections80

Sources7 archives

Databases and archives Arenicola defodiens's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility555 records↗

OBISOcean Biodiversity Information System377 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI80 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS932 records

Environmental DNA3 datasets · 3 countries80 detections

DNA & barcodingBOLD6 specimens

01Narrative

De Franse tap of zwarte tap is een borstelworm uit de familie Arenicolidae. De wetenschappelijke naam van de soort werd in 1993 gepubliceerd door Cadman & Nelson-Smith.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arenicola defodiens has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

eDNA detections80

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P673 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

87Gmostly conserved

126Tvariable

180Amostly conserved

204Gvariable

231Tvariable

471Cmostly conserved

585Gmostly conserved

GATATTGGAACAATATACTTCATCTTCGGAATCTGAGCTGGTCTCCTAGGTACCTCAATAAGACTACTTATTCGAACCGAACTAGGGCAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.44%

Haplotypes4

BIN1

Most divergent pair0.74%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arenicola marinasame genus14.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type932 records

Wild obs. + sensor433

Museum / vouchered409

Other90

Range

Area of Occupancy AOO692 km²

Depth

0–200 m sunlit219

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 5.7 m · max 41.7 m · 219 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 364≤1 km 17≤10 km 29>10 km 2

412 georeferenced · 21 without coordinates

Open the mapobservation + sensor433

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy80% within 1 km

≤100 m 3≤1 km 1≤10 km 1

5 georeferenced · 404 without coordinates

Open the institutions mapphysical evidence409

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Ilvolocation not on record	63
RWSlocation not on record	40
ARMS-MBONlocation not on record	9
730location not on record	7
Institut Francais pour l'Etude de la Merlocation not on record	5
630location not on record	4
CEFASlocation not on record	3
DASSHlocation not on record	3
PNHSlocation not on record	3
Natural History Museum Rotterdamlocation not on record	2
Gothenburg, SE	1
ZSROlocation not on record	1
Research Institute for Agriculture, Fisheries and Food (ILVO)location not on record	1

13 institutions · 142 of 409 vouchered records shown

09Environmental DNA80 detections

Where the DNA of Arenicola defodiens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found80

Studies independent surveys3

Countries3

Verifiable raw sequence linked62

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 80 detections have coordinates

Open the map3 countries0

Long-Term Ecological Research Site; LHI (Low…Long-Term Ecological Research Site; LHI (Low…Marina; semi-industrial; 9.5 - Subtidal Sand…Marine Protected Area; protected; 9.2 - Subt…North Sea

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.60 °C 9.20–15.0

Seasonal swing summer↔winter12.5 °C

Max temp (day)10.8 °C 10.5–16.8

Min temp (night)8.40 °C 7.80–12.4

Precipitation100 mm/mo 73.9–102

Air humidity64.4 % 62.6–65.3

Vapour deficit424 Pa 402–642

Cloud cover48.5 % 44.3–48.7

CHELSA 1981–2010, ~9 km grid, at location & month of 72 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)