Arenga obtusifolia

Mart. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Arecales/Arecaceae/Arenga

At a glance

Occurrence records27

Data sources10

Biological traits25

DNA specimens7

eDNA detections7

Sources10 archives

Databases and archives Arenga obtusifolia's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility27 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources25 traits

Occurrence & distributionGBIF27 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceCCDB2n = 32

01Narrative

أرينجة مفلطحة الأوراق هي نوع من النباتات تتبع جنس الأرينجة من الفصيلة الفوفلية.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Fruit length60 mm

Fruit width40 mm

Leaf length max11 000 mm

Plant height8 m

⚠ sources differ — GIFT: 8 m · TRY: 20 m

Life cycle & reproduction5

Deciduousnessevergreen

Dispersal typeanimal

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit colourgreen

Growth formtree

Habitat GIFTcanopy

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits6

Dbh max30 cm

Defenseno

Leaf spinesno

Plant support typefree-standing

Shoot length max2 000 cm

Shoot orientationerect

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arenga obtusifolia has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes3

GenBank sequences10

eDNA detections7

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK692446.1 ↗498 bp

ACGT

AATTGCAGAATCCCGCGAACCATCGATTCTTTGAACGCAAGTTGCGCCCGAGGCCATCCGGCCCAGGGTACGGCTGCCTGAGCGTCGATC …

Arenga obtusifolia voucher XTBG084 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL2★ITS4

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Arenga obtusifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Ploidydiploid inferred

Chromosome records32–322n range32median32mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 326×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · book-indian_vol2 +2

CCDB · ipcn-api-dl — Sarkar, A. K. 1987. Cytological assessment of Arenga Labill. and Areca L. of Palmae to ascertain their taxonomic affinities. Proc. Indian Sci. Congr. Assoc. 74(3,VI): 199–200.

CCDB · book-ipcn75-78 — Sarkar et al. 1977a

CCDB · book-indian_vol2 — Sharma, A.K. & Sarkar, S.K. 1957a ; Sarkar, A.K., Mallick, R. et al. 1977

CCDB · book-fedorov — Sharma A. K., Sarkar

CCDB · book-fedorov — Cm

CCDB · Cave1958 — Sharma & Sarkar 1957

n 161×CCDB · ipcn-api-dl

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type27 records

Wild obs. + sensor3

Museum / vouchered24

Range

Area of Occupancy AOO88 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤1 km 1>10 km 1

2 georeferenced · 1 without coordinates

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 23 without coordinates

Open the institutions mapphysical evidence24

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	8
Xiamen, CN	2
Paris, FR	1
Miami, US	1
Gujarat Biodiversity Gene Banklocation not on record	1
Universität Göttingenlocation not on record	1

6 institutions · 14 of 24 vouchered records shown · 10 without an institution code

09Environmental DNA7 detections

Where the DNA of Arenga obtusifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median32.9 °C 32.9–32.9

Seasonal swing summer↔winter11.9 °C

Max temp (day)39.2 °C

Min temp (night)26.4 °C

Precipitation7.00 mm/mo

Air humidity51.2 %

Moisture balance-227 mm/mo

Vapour deficit2,430 Pa

Wind speed4.00 m/s

Cloud cover9.00 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)