Arenga microcarpa

Becc. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Arecales/Arecaceae/Arenga

At a glance

Occurrence records185

Data sources6

Biological traits29

DNA specimens0

eDNA detections1

Sources6 archives

Databases and archives Arenga microcarpa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility185 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources29 traits

Occurrence & distributionGBIF185 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingNCBIsequences

01Narrative

أرينجة صغيرة الثمار هي نوع من النباتات تتبع جنس الأرينجة من الفصيلة الفوفلية.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTAusTraitsTRY

Size & morphology7

Fruit length16.5 mm

⚠ sources differ — AusTraits: 16.5 mm · GIFT: 14.4 mm

Fruit width16.5 mm

Fruit width max18 mm

Fruit width min15 mm

Leaf length1 100 mm

Leaf length max4 000 mm

Plant height6 m

⚠ sources differ — GIFT: 6 m · AusTraits: 7 m · TRY: 8 m

Life cycle & reproduction5

Deciduousnessevergreen

Life spanperennial

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Sex typemonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment9

Climberself-supporting

Epiphyteterrestrial

Fruit colourred

Fruit fleshinessfleshy

Fruit typeberry

Growth formshrub

⚠ sources differ — GIFT: shrub · AusTraits: palmoid

Habitat GIFTcanopy

Leaf compoundnesscompound

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

Other traits6

Dbh max15 cm

Defenseno

Leaf spinesno

Plant support typefree-standing

Shoot length max800 cm

Shoot orientationerect

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arenga microcarpa has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLJF344820.1 ↗606 bp

ACGT

AAGTGCTGGATTTAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGC …

Arenga microcarpa voucher 96188T MBC ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1

plant barcode

08Occurrence & distribution

Record type185 records

Wild obs. + sensor57

Museum / vouchered120

Cultivated / captive1

Other7

Origin

Native3

Range

Area of Occupancy AOO452 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 12

12 georeferenced · 45 without coordinates

Open the mapobservation + sensor57

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy53% within 1 km

≤100 m 7≤1 km 30≤10 km 28>10 km 5

70 georeferenced · 50 without coordinates

Open the institutions mapphysical evidence120

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Palmerston, AU	28
Canberra, AU	20
Kew, GB	19
Xiamen, CN	4
Brisbane, AU	4
Smithfield, AU	3
Cibinong, ID	2
Cambridge, US	1
Saint Louis, US	1
St. Paul, US	1

10 institutions · 83 of 120 vouchered records shown · 36 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Arenga microcarpa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.9 °C 23.9–23.9

Seasonal swing summer↔winter1.80 °C

Max temp (day)27.2 °C

Min temp (night)21.1 °C

Precipitation312 mm/mo

Air humidity69.7 %

Moisture balance185 mm/mo

Vapour deficit902 Pa

Wind speed2.00 m/s

Cloud cover51.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)