Arenga engleri

Becc. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Arecales/Arecaceae/Arenga

At a glance

Occurrence records3 920

Data sources9

Biological traits27

DNA specimens7

eDNA detections7

Sources9 archives

Databases and archives Arenga engleri's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 920 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources27 traits

Occurrence & distributionGBIF3 920 records

Environmental DNA1 datasets · 0 countries7 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceCCDB2n = 32

01Narrative

L'Arenga engleri, ou le palmier Formose, le palmier à sucre de Taiwan, le palmier à sucre nain ou le palmier Arenga de Taiwan, est une espèce de plante à fleurs de la famille des Arecaceae. Ce palmier dépasse rarement les 3 mètres de haut, avec un diamètre de stipe de 15 cm, et une envergure de 4 à 5 mètres tout au plus. Le palmier est originaire de Taïwan ainsi que des îles Ryukyu au Japon.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology8

Fruit length15 mm

Fruit width15 mm

Inflorescence length max50 cm

Inflorescence length min30 cm

Leaf length max4 500 mm

Plant height2.75 m

⚠ sources differ — GIFT: 2.75 m · TRY: 3.5 m

Plant height max3 m

Plant height min2 m

Life cycle & reproduction4

Deciduousnessevergreen

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit colourorange

Growth formshrub

Habitat GIFTunderstorey

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

Other traits6

Dbh max15 cm

Defenseno

Leaf spinesno

Plant support typefree-standing

Shoot length max400 cm

Shoot orientationerect

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arenga engleri has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes3

GenBank sequences10

eDNA detections7

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK692447.1 ↗498 bp

ACGT

AATTGCAGAATCCCGCGAACCATCGATTCTTTGAACGCAAGTTGCGCCTGAGGCCATCCGGCCCAGGGTACGGCTGCCTGAGCGTCGATC …

Arenga engleri voucher SCBG085 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL2★ITS4

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Arenga engleri carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Ploidydiploid inferred

Chromosome records32–322n range32median32mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 323×CCDB · ipcn-api-dl · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · ipcn-api-dl — Sarkar, A. K. 1987. Cytological assessment of Arenga Labill. and Areca L. of Palmae to ascertain their taxonomic affinities. Proc. Indian Sci. Congr. Assoc. 74(3,VI): 199–200.

CCDB · book-fedorov — Sato D. 1946 (D. 1955)

CCDB · book-atlas-flowering-plants — Sato 1946

n 161×CCDB · ipcn-api-dl

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type3 920 records

Wild obs. + sensor3 538

Museum / vouchered382

Range

Area of Occupancy AOO4 864 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 1 887≤1 km 328≤10 km 94>10 km 24

2 333 georeferenced · 1 205 without coordinates

Open the mapobservation + sensor3 538

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 2≤1 km 1≤10 km 4

7 georeferenced · 375 without coordinates

Open the institutions mapphysical evidence382

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Nishihara, JP	217
Taipei, TW	61
Tsukuba, JP	21
National Museum of Natural Sciencelocation not on record	12
Bronx, US	10
Nishihara, JP	10
Miami, US	9
Taipei, TW	7
Taipei, TW	6
Sanda, JP	5
Beijing, CN	4
South Kensington, GB	4
Kagoshima, JP	2
Paris, FR	1
Chiba, JP	1
Xiamen, CN	1
Guilin, CN	1
J.F.Oberlin Universitylocation not on record	1
Canadian Department of Agriculturelocation not on record	1
Saint Louis, US	1
Chongqing Museumlocation not on record	1

21 institutions · 376 of 382 vouchered records shown · 6 without an institution code

09Environmental DNA7 detections

Where the DNA of Arenga engleri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Arenga engleri

At a glance

Sources9 archives

Size & morphology8

Life cycle & reproduction4

Diet & foraging1

Habitat & environment7

Physiology & chemistry1

Other traits6

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type3 920 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions17 of 21 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type3 920 records