Arenga australasica

(H.Wendl. & Drude) S.T.Blake ex H.E.Moore · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Arecales/Arecaceae/Arenga

At a glance

Occurrence records154

Data sources6

Biological traits33

DNA specimens7

eDNA detections7

Sources6 archives

Databases and archives Arenga australasica's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility154 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources33 traits

Occurrence & distributionGBIF154 records

Environmental DNA1 datasets · 2 countries7 detections

DNA & barcodingBOLD · NCBI7 specimens

01Narrative

أرينجة أسترالاسية هي نوع من النباتات تتبع جنس الأرينجة من الفصيلة الفوفلية.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology10

Fruit length17.5 mm

Fruit length max26 mm

Fruit length min8 mm

Fruit width17.5 mm

Fruit width max28 mm

Fruit width min8 mm

Leaf length800 mm

Leaf length max4 000 mm

Plant height20 m

Seed length14.5 mm

Life cycle & reproduction6

Flowering timennnnnnnnnynn

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Resprouting capacitypartial_resprouting

Sex typemonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit colourred

Fruit fleshinessfleshy

Fruit typedrupe

Growth formtree

Habitat GIFTcanopy

Leaf compoundnesscompound

Woodinesswoody

Other traits6

Dbh max30 cm

Defenseno

Leaf spinesno

Plant support typefree-standing

Shoot length max2 000 cm

Shoot orientationerect

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arenga australasica has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes3

GenBank sequences10

eDNA detections7

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMK692437.1 ↗500 bp

ACGT

AATTGCAGAATCCCGCGAACCATCGATTCTTTGAACGCAAGTTGCGCCCGAGGCCATCCGGCCCAGGGTACGGCTGCCTGAGCGTCGATC …

Arenga australasica voucher XMBG190 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL3★ITS4

plant barcodefungal barcode

08Occurrence & distribution

Record type154 records

Wild obs. + sensor19

Museum / vouchered135

Origin

Native4

Range

Area of Occupancy AOO204 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy16% within 1 km

≤100 m 1≤1 km 2≤10 km 4>10 km 12

19 georeferenced

Open the mapobservation + sensor19

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy4% within 1 km

≤1 km 5≤10 km 127

132 georeferenced · 3 without coordinates

Open the institutions mapphysical evidence135

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Smithfield, AU	77
Brisbane, AU	29
Canberra, AU	13
Museo Entomologico de Leonlocation not on record	7
Mount Annan, AU	4
James Cook Townsvillelocation not on record	1
Kew, GB	1
John T. Waterhouse Herbariumlocation not on record	1
Gujarat Biodiversity Gene Banklocation not on record	1

9 institutions · 134 of 135 vouchered records shown

09Environmental DNA7 detections

Where the DNA of Arenga australasica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.4 °C 23.0–31.8

Seasonal swing summer↔winter15.2 °C

Max temp (day)33.9 °C 29.6–38.2

Min temp (night)20.7 °C 16.1–25.2

Precipitation11.3 mm/mo 7.90–14.7

Air humidity47.3 % 44.2–50.5

Moisture balance-185 mm/mo -218–-151

Vapour deficit2,027 Pa 1,705–2,350

Wind speed4.00 m/s

Cloud cover13.5 % 9.90–17.2

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)