Arenaria serpyllifolia
speciesAt a glance
Occurrence records248 084
Data sources10
Biological traits74
DNA specimens67
eDNA detections687
Sources10 archives
Databases and archives Arenaria serpyllifolia's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility248 084 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI687 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics67 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
Paleobiology DatabasePBDB consortiumfossil record↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources74 traits
Occurrence & distributionGBIF248 084 records
Environmental DNA4 datasets · 13 countries687 detections
DNA & barcodingBOLD · NCBI67 specimens
Genome at a glanceGIFT · GoaT · NCBI890 Mbp
01Narrative
La Sabline à feuilles de serpolet est une espèce de plantes herbacées de la famille des Caryophyllacées.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology27
Fruit length4.5 mm
⚠ sources differ — AusTraits: 4.5 mm · GIFT: 1 mm
Fruit length max4 mm
Fruit length min3 mm
Fruit width3 mm
Fruit width max2.2 mm
Fruit width min1.5 mm
Leaf length4 mm
⚠ sources differ — AusTraits: 4 mm · GIFT: 8 mm
Leaf length max12 mm
Leaf length min2 mm
Leaf mass0.768 mg
Leaf size32 mm²
⚠ sources differ — TRY: 32 mm² · LEDA: 18 mm² · GIFT: 10.75 mm²
Leaf width2.5 mm
⚠ sources differ — AusTraits: 2.5 mm · GIFT: 2 mm
Leaf width max7 mm
Leaf width min1 mm
Plant height0.139 m
⚠ sources differ — GIFT: 0.139 m · AusTraits: 0.3 m · LEDA: 0.165 m · TRY: 0.194 m
Plant height generative0.1 m
Plant height max0.5 m
Plant height min0.02 m
Seed length0.568 mm
⚠ sources differ — TRY: 0.568 mm · AusTraits: 0.6 mm · GIFT: 0.5 mm
Seed length max0.6 mm
Seed length min0.4 mm
Seed mass0.068 mg
⚠ sources differ — TRY: 0.068 mg · LEDA: 0.063 mg · GIFT: 0.065 mg
Seed mass max0.09 mg
Seed mass min0.055 mg
Seed volume0.038 mm³
Seed volume max0.061 mm³
Seed volume min0.019 mm³
Life cycle & reproduction18
Deciduousnesshibernal
⚠ sources differ — TRY: hibernal · GIFT: deciduous
Dehiscencedehiscent
Dispersal typeanimal
⚠ sources differ — LEDA: endozoochor · GIFT: anemochorous
Flower colourwhite
Flower length max4 mm
Flower length min2.5 mm
Flowering endJul
Flowering startMay
Flowering timeyynnnnnnyyyy
Life formannual
Life spanannual
⚠ sources differ — TRY: annual · AusTraits: annual biennial · LEDA: strict monocarpic bi-annuals and poly-annuals · GIFT: annual
Lifespan years2 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formchamaephyte
⚠ sources differ — LEDA: Chamaephyte · GIFT: therophyte
Reproduction asexualabsent
Seed number452
Self fertilizationpresent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment16
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max3 500 m
Elevation mean765 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typecapsule
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: herb · TRY: forb-annual
Habitat GIFTcrop fields, inhabited places, mountains, old fields, stony places
Leaf compoundnesssimple
Leaf formovate
Leaf shapeovate
Mycorrhiza typenon-mycorrhizal
Woodinessnon-woody
Physiology & chemistry9
Leaf C:N ratio30.86 g/g
Leaf c368 mg/g
Leaf dry-matter content (LDMC)277 mg/g
⚠ sources differ — TRY: 277 mg/g · LEDA: 220 mg/g
Leaf n10.15 mg/g
Leaf p4.2 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index0.5
Specific leaf area (SLA)17.7 mm²/mg
⚠ sources differ — TRY: 17.7 mm²/mg · LEDA: 19.08 mm²/mg · GIFT: 23.11 mm²/mg
Other traits2
Diaspore typeone-seeded generative dispersule
Shoot orientationprostrate
05DNA & barcoding67 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arenaria serpyllifolia has left across the world's sequence archives.
At a glance
DNA specimens67
Marker genes9
GenBank sequences9
eDNA detections687
Countries13
The DNA barcodea real sequence read deposited for this species
ATCATTGTCGAAACCTGCCCAGCAGAAGACCAGCGAACATGTTCACTACTCGGCGAGGGCGTTGTCTGGAGCCTGTGCACCCGCTCGCCC …
Arenaria serpyllifolia voucher NIBRVP0000788169 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL4★rbcLa★ITS4★ITS1★ITS2atpF-atpHrpoC1trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceGIFT · GoaT · NCBI
The complete instruction manual Arenaria serpyllifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size889 980 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Arenaria serpyllifolia0.89 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 40 n = 20
Ploidy4× tetraploid · measured
Chromosome records10–442n range40median40mode9records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 403×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · GIFT · GIFT (floras)
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
GIFT · GIFT (floras)
2n 202×GoaT · DTOL Flowering Plants Estimates Kew · GIFT · GIFT (floras)
GoaT · DTOL Flowering Plants Estimates Kew
GIFT · GIFT (floras)
2n 442×GoaT · DTOL Flowering Plants Estimates Kew · GIFT · GIFT (floras)
GoaT · DTOL Flowering Plants Estimates Kew
GIFT · GIFT (floras)
2n 101×GIFT · GIFT (floras)
GIFT · GIFT (floras)
2n 301×GIFT · GIFT (floras)
GIFT · GIFT (floras)
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
tetraploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness96.1% BUSCO
08Occurrence & distribution
Record type248 084 records
Wild obs. + sensor227 786
Museum / vouchered19 349
Cultivated / captive70
Fossil1
Other878
Origin
Native22 954
Introduced359
Range
Area of Occupancy AOO330 836 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy33% within 1 km
≤100 m 34 777≤1 km 27 063≤10 km 125 111>10 km 1 490
188 441 georeferenced · 39 345 without coordinates
Open the mapobservation + sensor227 786
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy38% within 1 km
≤100 m 968≤1 km 4 218≤10 km 7 221>10 km 1 088
13 495 georeferenced · 5 854 without coordinates
Open the institutions mapphysical evidence19 349
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 2>10 km 19
21 georeferenced · 49 without coordinates
Open the mapnot free-living70
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions218 of 401 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 7 633 |
| Helsinki, FI | 722 |
| Olocation not on record | 549 |
| LDlocation not on record | 517 |
| Berlin, DE | 414 |
| Moscow State Universitylocation not on record | 375 |
| BFLlocation not on record | 255 |
| Philadelphia, US | 241 |
| Beijing, CN | 240 |
| Trondheim, NO | 225 |
| BRNUlocation not on record | 202 |
| Salzburg, AT | 201 |
| Yangling, CN | 195 |
| Chongqing Museumlocation not on record | 164 |
| Turku, FI | 151 |
| MAlocation not on record | 128 |
| Provincia di Livornolocation not on record | 125 |
| Bergen, NO | 120 |
| Uniwersytet Warszawskilocation not on record | 119 |
| Adam Mickiewicz University in Poznańlocation not on record | 118 |
| Chengdu, CN | 113 |
| Kuopio, FI | 105 |
| València, ES | 104 |
| KMNlocation not on record | 100 |
| Bronx, US | 99 |
| Oskarshamn, SE | 95 |
| MeiseBGlocation not on record | 95 |
| Tartu, EE | 94 |
| Oulu, FI | 93 |
| TROMlocation not on record | 91 |
| GMBAlocation not on record | 90 |
| Kunming, CN | 72 |
| BDBClocation not on record | 71 |
| Museo Entomologico de Leonlocation not on record | 69 |
| Ann Arbor, US | 67 |
| South Kensington, GB | 67 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 67 |
| Barcelona, ES | 67 |
| TUR-Alocation not on record | 66 |
| Uppsala, SE | 64 |
| CJBGlocation not on record | 64 |
| Christchurch, NZ | 63 |
| Nanjing, CN | 62 |
| Vitoria, ES | 62 |
| Wlocation not on record | 62 |
| Kochi, JP | 60 |
| QAUlocation not on record | 58 |
| Brussel, BE | 55 |
| SLU Artdatabankenlocation not on record | 55 |
| Guangzhou, CN | 55 |
| BClocation not on record | 54 |
| Shinshu Universitylocation not on record | 54 |
| Zürich, CH | 54 |
| Pullman, US | 51 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 51 |
| Madison, US | 51 |
| Entomological Society of Latvialocation not on record | 50 |
| Fort Worth, US | 46 |
| Moscow, US | 43 |
| Uniwersytet Śląski w Katowicachlocation not on record | 43 |
| Tallinn, EE | 42 |
| San Sebastián, ES | 41 |
| Burlington, US | 40 |
| GJOlocation not on record | 40 |
| Zürich, CH | 37 |
| Nagano City, JP | 37 |
| Toyama, JP | 36 |
| Tomioka, JP | 36 |
| Mlocation not on record | 35 |
| Allentown, US | 34 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 33 |
| University of Stellenboschlocation not on record | 33 |
| Missoula, US | 32 |
| Bern, CH | 31 |
| Pamplona, ES | 31 |
| Toronto, CA | 31 |
| WTUlocation not on record | 31 |
| Chapel Hill, US | 30 |
| Görlitz, DE | 30 |
| Jyväskylä, FI | 30 |
| Austin, US | 29 |
| College Park, US | 28 |
| New Haven, US | 27 |
| Auckland, NZ | 26 |
| Saint Louis, US | 26 |
| Nagatoro-machi, Chichibu-gun, JP | 25 |
| Frankfurt am Main | 25 |
| Guilin, CN | 25 |
| Madrid, ES | 25 |
| BAYLUlocation not on record | 25 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 24 |
| Uniwersytet Jagiellońskilocation not on record | 24 |
| Wuhan, CN | 24 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 24 |
| Wellington, NZ | 24 |
| KIRMlocation not on record | 23 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 23 |
| Bangkok, TH | 23 |
| Pittsburg, US | 22 |
| Anhui Normal Universitylocation not on record | 21 |
| National Institute of Biological Resourceslocation not on record | 21 |
| KR | 21 |
| Bando, JP | 20 |
| Pamplona, ES | 20 |
| Tampa, US | 20 |
| Lanzhou, CN | 20 |
| KURAlocation not on record | 20 |
| Granada, ES | 20 |
| Salamanca, ES | 20 |
| Bloomington, US | 19 |
| Québec, CA | 18 |
| PRClocation not on record | 18 |
| Natural History Museum Rotterdamlocation not on record | 17 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 17 |
| Green Bay, US | 17 |
| Chiba, JP | 17 |
| Xining, CN | 16 |
| Fukushima Universitylocation not on record | 16 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 16 |
| Williamsburg, US | 16 |
| Nijmegen, NL | 16 |
| Urumqi, CN | 16 |
| Longwood Universitylocation not on record | 16 |
| UGentlocation not on record | 15 |
| JP | 14 |
| Acadia Universitylocation not on record | 14 |
| Durham, US | 14 |
| EEZA-CSIClocation not on record | 14 |
| Chengdu, CN | 14 |
| DBF-NHMDlocation not on record | 13 |
| Jena Microbial Resource Collectionlocation not on record | 13 |
| Xinxiang, CN | 13 |
| Phyletisches Museum Jenalocation not on record | 13 |
| Alicante, ES | 13 |
| Zhengzhou, CN | 13 |
| College of the Atlantic, Museumlocation not on record | 12 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 12 |
| Osaka, JP | 12 |
| Porvoo, FI | 12 |
| Bozeman, US | 12 |
| Taipei, TW | 12 |
| Hobart, AU | 12 |
| Emporia, US | 11 |
| Universidad Católica de Santa Maríalocation not on record | 11 |
| Jackson, US | 11 |
| DMZ botanic gardenlocation not on record | 11 |
| GZUlocation not on record | 11 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 11 |
| Jaén, ES | 11 |
| Arcata, US | 11 |
| 河南豫北黄河故道湿地鸟类国家级自然保护区location not on record | 10 |
| Strecker Museum, Baylor Universitylocation not on record | 10 |
| Canberra, AU | 10 |
| BGBMlocation not on record | 10 |
| Hangzhou, CN | 10 |
| Mississippi State, US | 10 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 10 |
| Taipei, TW | 10 |
| Columbia, US | 10 |
| Boise, US | 10 |
| Guiyang, CN | 9 |
| Changsha, CN | 9 |
| Xian, CN | 9 |
| KOMlocation not on record | 9 |
| SZUlocation not on record | 9 |
| WNNUlocation not on record | 9 |
| Awka, NG | 9 |
| Siouxland Heritage Museumlocation not on record | 9 |
| Wuhan, CN | 9 |
| Seoul, KR | 9 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 9 |
| Elocation not on record | 9 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 8 |
| Uniwersytet Opolskilocation not on record | 8 |
| Forssa, FI | 8 |
| Staten Island, US | 8 |
| AUAlocation not on record | 8 |
| John May Museum of Natural Historylocation not on record | 8 |
| Corvallis, US | 8 |
| Ischia Marine Centrelocation not on record | 8 |
| Iwate Prefectural Museumlocation not on record | 8 |
| nbflocation not on record | 8 |
| BSBIlocation not on record | 8 |
| Knoxville, US | 8 |
| Provo, US | 8 |
| Porrentruy, CH | 7 |
| WINlocation not on record | 7 |
| Dresden, DE | 7 |
| Fulda, DE | 7 |
| Kyoto Universitylocation not on record | 7 |
| Tuscaloosa, US | 7 |
| Taipei, TW | 7 |
| New Brunswick, US | 7 |
| Zhejiang Universitylocation not on record | 7 |
| Miami, US | 7 |
| Rotorua, NZ | 7 |
| Riverside, US | 7 |
| Dover, US | 7 |
| Chadron, US | 7 |
| Frauenfeld, CH | 7 |
| DOI/NPS, Greenbelt Parklocation not on record | 6 |
| Tokushima, JP | 6 |
| Philadelphia, US | 6 |
| Edinburgh, GB | 6 |
| CASlocation not on record | 6 |
| Korea National Arboretumlocation not on record | 6 |
| EL PASO, US | 6 |
| Clemson, US | 6 |
| Tilburg, NL | 6 |
| UniKSlocation not on record | 6 |
| GAlocation not on record | 6 |
| IDElocation not on record | 6 |
| San Isidro, AR | 6 |
| Morgantown, US | 6 |
| Whitewater, US | 6 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 5 |
| McWane Science Centerlocation not on record | 5 |
| St. Paul, US | 5 |
| ZRC-SAZUlocation not on record | 5 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 5 |
| Dekalb, US | 5 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 5 |
| US | 5 |
| Jefferson City, US | 5 |
| Logan, US | 5 |
| Xiamen, CN | 5 |
| Sevilla, ES | 5 |
| Millersville, US | 4 |
| Xian, CN | 4 |
| Bourges, FR | 4 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 4 |
| Guiyang, CN | 4 |
| Whitehorse, CA | 4 |
| Winterthur, CH | 4 |
| Zhejiang Museum of Natural Historylocation not on record | 4 |
| Washington, US | 4 |
| Norfolk, US | 4 |
| Portland, US | 4 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 4 |
| Mount Annan, AU | 4 |
| NMBU:MINAlocation not on record | 4 |
| Paris, FR | 4 |
| National Museum Waleslocation not on record | 4 |
| UIBlocation not on record | 4 |
| Western Carolina Universitylocation not on record | 4 |
| DNSMlocation not on record | 4 |
| Harrisonburg, US | 4 |
| Tromso University Museumlocation not on record | 4 |
| Gijón, ES | 4 |
| Nanjing, CN | 4 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 4 |
| Museo Achille Folettolocation not on record | 4 |
| Montréal, CA | 4 |
| Monastir, TN | 3 |
| GB | 3 |
| Karlsruhe, DE | 3 |
| Guangzhou, CN | 3 |
| Oswego, US | 3 |
| Akita Prefectural Museumlocation not on record | 3 |
| Stockholm, SE | 3 |
| Davenport, US | 3 |
| Corrientes, AR | 3 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 3 |
| Hangzhou Normal Collegelocation not on record | 3 |
| FFPRIlocation not on record | 3 |
| Pocatello, US | 3 |
| Brookings, US | 3 |
| Claremont, US | 3 |
| CICYTEXlocation not on record | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| Vancouver, CA | 3 |
| Valdosta State Universitylocation not on record | 3 |
| H-Schuhwlocation not on record | 3 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 3 |
| Flagstaff, US | 3 |
| University of Guelph, OAC Herbariumlocation not on record | 3 |
| Finnish Museum of Natural Historylocation not on record | 3 |
| Durham, US | 3 |
| Sion, CH | 3 |
| Los Angeles, US | 3 |
| Ypsilanti, US | 3 |
| Tianjin Natural History Museumlocation not on record | 2 |
| Kew, GB | 2 |
| KNFHClocation not on record | 2 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 2 |
| Caldwell, US | 2 |
| Bratislava, SK | 2 |
| Denver, US | 2 |
| TAIElocation not on record | 2 |
| Glarus, CH | 2 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 2 |
| JBSlocation not on record | 2 |
| Stephenville, US | 2 |
| Banyoles, ES | 2 |
| Springfield, US | 2 |
| Shanxi Institute of Biologylocation not on record | 2 |
| Bureau of Land Management, Medford District Officelocation not on record | 2 |
| Chicago, US | 2 |
| Canadian Department of Agriculturelocation not on record | 2 |
| Podgorica, ME | 2 |
| Badajoz, ES | 2 |
| KIWElocation not on record | 2 |
| Göteborg, SE | 2 |
| Museo universitario di Chietilocation not on record | 2 |
| Universidad de La Salle (La Salle)location not on record | 2 |
| Texas Lutheran Universitylocation not on record | 2 |
| Córdoba, ES | 2 |
| Angwin, US | 2 |
| Lincoln, US | 2 |
| Academy of Sciences of the Republic of Uzbekistanlocation not on record | 2 |
| University of Southern Mississippilocation not on record | 2 |
| Jiujiang Forestry Institutelocation not on record | 2 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 2 |
| Long Beach, US | 2 |
| Chongqing Natural History Museumlocation not on record | 2 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 2 |
| Spearfish, US | 2 |
| KNAMlocation not on record | 2 |
| Nagasaki University - Fisherieslocation not on record | 2 |
| Kirksville, US | 2 |
| Minia, EG | 2 |
| Fayetteville, US | 2 |
| Johnson City, US | 2 |
| University of Tennessee at Chattanoogalocation not on record | 2 |
| Université Lavallocation not on record | 2 |
| OLAlocation not on record | 2 |
| Saint John, CA | 2 |
| Hebei Normal Universitylocation not on record | 2 |
| Mohonk Preservelocation not on record | 1 |
| Tall Timbers Research Stationlocation not on record | 1 |
| Museum of the Rockieslocation not on record | 1 |
| NSMKlocation not on record | 1 |
| BISHlocation not on record | 1 |
| Altos de Pipe, VE | 1 |
| ULBF-AGRlocation not on record | 1 |
| Cape Town, ZA | 1 |
| JBRJlocation not on record | 1 |
| Dehra Dun, IN | 1 |
| ENHMlocation not on record | 1 |
| Tula State Universitylocation not on record | 1 |
| Northridge, US | 1 |
| University of Alberta Museumslocation not on record | 1 |
| MHNAIXlocation not on record | 1 |
| Sanda, JP | 1 |
| San Angelo, US | 1 |
| Tennessee Technological Universitylocation not on record | 1 |
| BG-NMNHSlocation not on record | 1 |
| DOI/NPS, San Juan Island National Historical Parklocation not on record | 1 |
| Brisbane, AU | 1 |
| Lord Fairfax Community Collegelocation not on record | 1 |
| Sant Julià de Lòria, AD | 1 |
| Chengdu, CN | 1 |
| Chicago, US | 1 |
| München, DE | 1 |
| Albuquerque, US | 1 |
| Edmonton, CA | 1 |
| Qufu Normal Universitylocation not on record | 1 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 1 |
| Cheney, US | 1 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 1 |
| Shanghai, CN | 1 |
| SABGlocation not on record | 1 |
| Beijing, CN | 1 |
| Asheville, US | 1 |
| Beijing Natural History Museumlocation not on record | 1 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 1 |
| Central Botanical Gardenlocation not on record | 1 |
| Tacoma, US | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| Honolulu, US | 1 |
| Jishou Universitylocation not on record | 1 |
| Central China Normal Universitylocation not on record | 1 |
| HUFDlocation not on record | 1 |
| Peking Universitylocation not on record | 1 |
| SEFlocation not on record | 1 |
| POL003location not on record | 1 |
| NoColllocation not on record | 1 |
| Lausanne, CH | 1 |
| Wuzhou, CN | 1 |
| Due West, US | 1 |
| Ciudad Autónoma de Buenos Aires, AR | 1 |
| Hamilton, US | 1 |
| LfUlocation not on record | 1 |
| Phoenix, US | 1 |
| Brock University (BU)location not on record | 1 |
| Shenzhen, CN | 1 |
| Arequipa, PE | 1 |
| UoB-IBlocation not on record | 1 |
| LINUlocation not on record | 1 |
| Maryland Department of Natural Resourceslocation not on record | 1 |
| San Luis Obispo, US | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Audubon Society -- Silver Bluff Audubon Center and Sanctuarylocation not on record | 1 |
| Xiangtan City, CN | 1 |
| “Manash Kozybayev North Kazakhstan University" NPLClocation not on record | 1 |
| BMlocation not on record | 1 |
| UFSMlocation not on record | 1 |
| Herbarium of South China Botanical Gardenlocation not on record | 1 |
| Research Collection of B. A. Bennettlocation not on record | 1 |
| China Agricultural Universitylocation not on record | 1 |
| Weber State Universitylocation not on record | 1 |
401 institutions · 18 333 of 19 349 vouchered records shown · 786 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA687 detections
Where the DNA of Arenaria serpyllifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found687
Studies independent surveys4
Countries13
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 687 detections have coordinates
Open the map13 countries0
on rocky outcrop
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median6.90 °C 6.90–6.90
Seasonal swing summer↔winter21.7 °C
Max temp (day)10.9 °C
Min temp (night)1.90 °C
Precipitation105 mm/mo
Air humidity58.7 %
Moisture balance58.6 mm/mo
Vapour deficit414 Pa
Wind speed3.10 m/s
Cloud cover46.3 %
CHELSA 1981–2010, ~9 km grid, at location & month of 668 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.