Arenaria pseudofrigida

(Ostenf. & O.C.Dahl) Schischk. & Knorring · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Caryophyllaceae/Arenaria

At a glance

Occurrence records1 104

Data sources10

Biological traits20

DNA specimens20

eDNA detections9

Sources10 archives

Databases and archives Arenaria pseudofrigida's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 104 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources20 traits

Occurrence & distributionGBIF1 104 records

Environmental DNA1 datasets · 3 countries9 detections

DNA & barcodingBOLD · NCBI20 specimens

Genome at a glanceCCDB2n = 40

01Narrative

Arenaria pseudofrigida is a species of flowering plant belonging to the family Caryophyllaceae. Its native range is Subarctic.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Leaf size6.87 mm²

Plant height0.05 m

Plant height max0.07 m

Plant height min0.04 m

Life cycle & reproduction5

Flowering endSep

Flowering startJul

Life formsubshrub

Life spanperennial

Lifespan years2 years

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTtundra

Woodinessnon-woody

Physiology & chemistry3

Leaf n16.5 mg/g

Leaf p2.13 mg/g

Specific leaf area (SLA)14.88 mm²/mg

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arenaria pseudofrigida has left across the world's sequence archives.

At a glance

DNA specimens20

Marker genes6

GenBank sequences6

eDNA detections9

Countries3

The DNA barcodea real sequence read deposited for this species

ITSKT960072.1 ↗344 bpGreenland · 2012

ACGT

TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCTTCTGGCTGAGGGCACGTCTGCCTGGGCGTCACGCATCG …

Arenaria pseudofrigida voucher ZA2012-1930 internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL3★rbcLa★ITS3★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Arenaria pseudofrigida carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Ploidypolyploid inferred

Chromosome records40–402n range40median40mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 402×CCDB · ipcn-api-dl · CCDB · eflora

CCDB · ipcn-api-dl — Engelskjon, T. 1979. Chromosome numbers in vascular plants from Norway, including Svalbard. Opera Bot. 52: 1–38.

CCDB · eflora

n 202×CCDB · Cave1958 · CCDB · Cave1963

CCDB · Cave1958 — Jorgensen et al. 1958

CCDB · Cave1963 — Favarger 1963b

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.711 ↗

08Occurrence & distribution

Record type1 104 records

Wild obs. + sensor616

Museum / vouchered482

Other6

Range

Area of Occupancy AOO1 224 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 446≤1 km 27≤10 km 76>10 km 17

566 georeferenced · 50 without coordinates

Open the mapobservation + sensor616

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 31≤1 km 101≤10 km 201>10 km 78

411 georeferenced · 71 without coordinates

Open the institutions mapphysical evidence482

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Olocation not on record	95
Helsinki, FI	88
TROMlocation not on record	87
Trondheim, NO	40
Oulu, FI	35
Moscow State Universitylocation not on record	28
Turku, FI	23
LDlocation not on record	22
TUR-Alocation not on record	14
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	12
Tromso University Museumlocation not on record	5
Kuopio, FI	3
University of Helsinkilocation not on record	3
Jyväskylä, FI	3
NMBU:MINAlocation not on record	3
Bergen, NO	2
Kandalaksha State Nature Reservelocation not on record	2
Porvoo, FI	2
Oskarshamn, SE	2
BRNUlocation not on record	1
Stockholm, SE	1
Wlocation not on record	1
NTNU University Museum, Department of Natural Historylocation not on record	1
Salamanca, ES	1
Ann Arbor, US	1

25 institutions · 475 of 482 vouchered records shown · 7 without an institution code

09Environmental DNA9 detections

Where the DNA of Arenaria pseudofrigida was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median5.20 °C -0.8–10.2

Seasonal swing summer↔winter20.5 °C

Max temp (day)5.60 °C 0.4–12.2

Min temp (night)3.20 °C -3.70–6.90

Precipitation65.0 mm/mo 26.7–112

Air humidity65.8 % 55.1–67.2

Moisture balance-0.5 mm/mo -91.3–32.2

Vapour deficit360 Pa 253–427

Wind speed5.50 m/s 2.60–6.60

Cloud cover65.9 % 38.9–71.3

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Arenaria pseudofrigida

At a glance

Sources10 archives

Size & morphology4

Life cycle & reproduction5

Diet & foraging1

Habitat & environment7

Physiology & chemistry3

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 104 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 25 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 104 records