Arenaria paludicola — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Caryophyllaceae/Arenaria

At a glance

Occurrence records150

Data sources7

Biological traits9

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Arenaria paludicola's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility150 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF150 records

DNA & barcodingNCBIsequences

01Narrative

Arenaria paludicola is a species of flowering plant in the family Caryophyllaceae known by the common names marsh sandwort and swamp sandwort. The plant grows in wet areas, such as marsh and bog.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial or helophyte

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arenaria paludicola has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

The DNA barcodea real sequence read deposited for this species

ITSMZ388073.1 ↗600 bp

ACGT

TCGAAACCTGCAAAGCAGAACGACCAGGAACACGTTTTCATTCACGGACCAAGGAGCGCTGCTAGCTTCCTTGAGGAGCTACTCGACCTT …

Minuartia paludicola voucher TENN:Kral 82342 internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS2

fungal barcode

08Occurrence & distribution

Record type150 records

Wild obs. + sensor21

Museum / vouchered125

Other4

Range

Area of Occupancy AOO352 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy16% within 1 km

≤100 m 2≤1 km 1>10 km 16

19 georeferenced · 2 without coordinates

Open the mapobservation + sensor21

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy77% within 1 km

≤100 m 65≤1 km 10≤10 km 17>10 km 5

97 georeferenced · 28 without coordinates

Open the institutions mapphysical evidence125

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Durango, MX	29
Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record	29
Mexico City, MX	14
San Luis Obispo, US	9
Riverside, US	6
Santa Barbara, US	6
Pacific Lutheran Universitylocation not on record	4
Berlin, DE	3
Claremont, US	3
Irvine, US	2
San Jose, US	2
WTUlocation not on record	2
Mexico City, MX	2
Austin, US	2
Davis, US	1
Tampa, US	1
Saint Louis, US	1
Giardini Botanici Hanburylocation not on record	1
Los Angeles, US	1

19 institutions · 118 of 125 vouchered records shown · 7 without an institution code