Arenaria norvegica

Gunnerus · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Caryophyllaceae/Arenaria

At a glance

Occurrence records3 199

Data sources10

Biological traits15

DNA specimens26

eDNA detections11

Sources10 archives

Databases and archives Arenaria norvegica's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 199 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics26 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources15 traits

Occurrence & distributionGBIF3 199 records

Environmental DNA1 datasets · 4 countries11 detections

DNA & barcodingBOLD · NCBI26 specimens

Genome at a glanceCCDB2n = 80

01Narrative

Arenaria norvegica, also known as Arctic, English or Norwegian sandwort, is a low growing plant in the family Caryophyllaceae, found in northwest Europe. The diploid chromosome number is 2n=80. There are two recognised subspecies.Flora of NW Europe

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTLEDATRYWCVP

Size & morphology4

Plant height0.038 m

⚠ sources differ — GIFT: 0.038 m · LEDA: 0.037 m · TRY: 0.03 m

Seed mass0.22 mg

Seed mass max0.24 mg

Seed mass min0.22 mg

Life cycle & reproduction2

Life formannual or subshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Mycorrhiza typearbuscular

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding26 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arenaria norvegica has left across the world's sequence archives.

At a glance

DNA specimens26

Marker genes6

GenBank sequences10

eDNA detections11

Countries4

The DNA barcodea real sequence read deposited for this species

ITSKX167760.1 ↗448 bpUnited Kingdom · 2012

ACGT

TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCTTCTGGCTGAGGGCACGTCTGCCTGGGCGTCACGCATCG …

Arenaria norvegica voucher RBGE156 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL5★rbcLa★ITS1★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Arenaria norvegica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 80 n = 40

Ploidypolyploid inferred

Chromosome records80–802n range80median80mode17records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 8017×CCDB · brit-fl · CCDB · nw-europe-fl · CCDB · fl-europaea +7

CCDB · brit-fl — Blackburn, K.B., Morton, J.K. New Phytol. 56: 344-351 (1957)

CCDB · brit-fl — Halliday, G. Watsonia 4: 207-210 (1960)

CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=1886

CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=1887

CCDB · fl-europaea — LOve & LOve, 1956

CCDB · ipcn-api-dl — Engelskjon, T. 1979. Chromosome numbers in vascular plants from Norway, including Svalbard. Opera Bot. 52: 1–38.

CCDB · book-ipcn67-71 — GADELLA, T.W.J., & E. KLIPHUIS. 1971. In IOPB chromosome number reports XXXI. Taxon 20: 157-160-:--

CCDB · book-fedorov — Horn (D. 1955)

CCDB · book-fedorov — Bocher, Larsen 1950

CCDB · book-fedorov — Nordhagen 1954b

CCDB · book-fedorov — LOve A., Love D.1956b

CCDB · book-fedorov — Blackburn, Morton 1957

CCDB · book-fedorov — Halliday 1958, 1960

CCDB · book-atlas-flowering-plants — Scand., Scotland

CCDB · Cave1956 — Love & Love b

CCDB · Cave1956supp — Nordhagen 1954

CCDB · Cave1957 — Blackburn & Morton

n 401×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Engelskjon, T. 1979. Chromosome numbers in vascular plants from Norway, including Svalbard. Opera Bot. 52: 1–38.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type3 199 records

Wild obs. + sensor2 133

Museum / vouchered1 060

Cultivated / captive1

Other5

Origin

Native6

Range

Area of Occupancy AOO7 660 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 476≤1 km 130≤10 km 80>10 km 4

690 georeferenced · 1 443 without coordinates

Open the mapobservation + sensor2 133

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 84≤1 km 222≤10 km 303>10 km 99

708 georeferenced · 352 without coordinates

Open the institutions mapphysical evidence1 060

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
TROMlocation not on record	273
Olocation not on record	206
Garðabær, IS	129
Trondheim, NO	111
LDlocation not on record	108
	78
Uppsala, SE	55
Bergen, NO	22
Helsinki, FI	11
Oskarshamn, SE	8
TUR-Alocation not on record	7
Turku, FI	6
Tromso University Museumlocation not on record	5
Oulu, FI	4
Provincia di Livornolocation not on record	4
South Kensington, GB	4
SLU Artdatabankenlocation not on record	4
NMBU:MINAlocation not on record	4
National Museum Waleslocation not on record	3
Royal Botanic Garden Edinburghlocation not on record	2
Uniwersytet Jagiellońskilocation not on record	1
nbflocation not on record	1
Brock University (BU)location not on record	1
Wellington, NZ	1
MeiseBGlocation not on record	1
Umeå Universitylocation not on record	1
Finnish Museum of Natural Historylocation not on record	1
Bronx, US	1
Uniwersytet Śląski w Katowicachlocation not on record	1
KMNlocation not on record	1

30 institutions · 1 054 of 1 060 vouchered records shown · 6 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA11 detections

Where the DNA of Arenaria norvegica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.8 °C 7.80–13.2

Seasonal swing summer↔winter14.7 °C

Max temp (day)13.9 °C 8.40–15.8

Min temp (night)7.80 °C 5.60–10.7

Precipitation84.7 mm/mo 57.9–143

Air humidity64.8 % 62.7–68.4

Moisture balance23.3 mm/mo

Vapour deficit479 Pa 370–529

Wind speed4.80 m/s

Cloud cover57.0 % 52.0–65.9

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Arenaria norvegica

At a glance

Sources10 archives

Size & morphology4

Life cycle & reproduction2

Diet & foraging1

Habitat & environment7

Physiology & chemistry1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type3 199 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions12 of 30 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 199 records