Arenaria montana

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Caryophyllaceae/Arenaria

At a glance

Occurrence records12 780

Data sources9

Biological traits16

DNA specimens3

eDNA detections2

Sources9 archives

Databases and archives Arenaria montana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility12 780 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Occurrence & distributionGBIF12 780 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 28

01Narrative

Arenaria montana, la Sabline des montagnes, est une espèce de plantes herbacées de la famille des Caryophyllacées.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology2

Plant height0.192 m

Seed mass0.55 mg

Life cycle & reproduction3

Dispersal typeself

Life formsubshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Growth formherb

Woodinessnon-woody

Physiology & chemistry3

Leaf n26.68 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)25.25 mm²/mg

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arenaria montana has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes5

GenBank sequences5

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSDQ901478.1 ↗235 bp

ACGT

AGCAGAACGACCCGAGAACATGTTATCTACTCGGTCGTGGTGCGTTGTGGGATGCCCTGTGCGCTCGCTCGCCCCGCTACCGGCTGGGGA …

Arenaria montana internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★trnL-F★ITS3★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Arenaria montana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidydiploid inferred

Chromosome records20–302n range28median28mode13records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 285×CCDB · fl-europaea · CCDB · book-fedorov · CCDB · Cave1963 +1

CCDB · fl-europaea — Favarger, 1962

CCDB · book-fedorov — Favarger 1962b

CCDB · Cave1963 — Favarger 1962a

CCDB · CromoCat 2015 — Favarger, C. (1962). Contribution a l'étude cytologique des genres Minuartia et Arenaria. Bull. Soc. Neuchât. Sci. Nat. 85: 53-81.

CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid

2n 204×CCDB · iber-fl · CCDB · book-fedorov · CCDB · Cave1957 +1

CCDB · iber-fl — The incidence of polyploidy in the Caryophyllaceae of Britain and of Portugal. Blackburn, K. B. & J. K. Morton.New Phytol.56: 344-351(1957).

CCDB · book-fedorov — Blackburn, Morton 1957

CCDB · Cave1957 — Blaokburn & Morton

CCDB · CromoCat 2015 — Blackburn, K. B. & Morton, J. K. (1957). The incidence of polyploidy in the Caryophyllaceae of Britain and of Portugal. New Phytol. 56(3): 344-351.

2n 304×CCDB · iber-fl · CCDB · book-ipcn67-71 · CCDB · CromoCat 2015

CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. III. Caryophyllaceae Fernandes, A. & M. T. Leitao.Bol. Soc. Brot. ser. 245: 143-176(1971).

CCDB · book-ipcn67-71 — FERNANDES, A., & M.T. LEITAO. 1971. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal III. Cariophyllaceae. Bol. soc. Brot. 45 (ser. 2): 143-176.

CCDB · CromoCat 2015 — Fernandes, A. & Leitão, M. T. (1971). Contribution à la connaissance cytotaxinomique des Spermatophyta du Portugal. III. Caryophyllaceae. Bol. Soc. Brot. 45: 143-176.

CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid

n 145×CCDB · book-ipcn65 · CCDB · book-ipcn73-74 · CCDB · Cave1963 +1

CCDB · book-ipcn65 — Favarger 1962

CCDB · book-ipcn73-74 — SCHOTSMAN, H.D. 1970. Contribution a la caryologie des angiospermes de la Sologne et du Val de Loire. Bull. Centr. Etudes Rech. Sci. 8: 21-63.

CCDB · Cave1963 — Favarger 1962a

CCDB · CromoCat 2015 — Favarger, C. (1962). Contribution a l'étude cytologique des genres Minuartia et Arenaria. Bull. Soc. Neuchât. Sci. Nat. 85: 53-81.

CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.794 ↗

08Occurrence & distribution

Record type12 780 records

Wild obs. + sensor12 362

Museum / vouchered418

Origin

Native265

Introduced5

Range

Area of Occupancy AOO22 140 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 3 583≤1 km 942≤10 km 4 337>10 km 139

9 001 georeferenced · 3 361 without coordinates

Open the mapobservation + sensor12 362

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy71% within 1 km

≤100 m 10≤1 km 152≤10 km 64>10 km 3

229 georeferenced · 189 without coordinates

Open the institutions mapphysical evidence418

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 42 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MAlocation not on record	78
CICYTEXlocation not on record	65
BClocation not on record	44
San Sebastián, ES	41
College of the Atlantic, Museumlocation not on record	32
Barcelona, ES	25
Salamanca, ES	18
València, ES	16
Entomological Society of Latvialocation not on record	16
Universidad del Pais Vasco (UPV/EHU)location not on record	8
South Kensington, GB	6
Vitoria, ES	6
Badajoz, ES	6
Wlocation not on record	5
Madrid, ES	4
Pamplona, ES	4
OLAlocation not on record	3
Bourges, FR	3
LDlocation not on record	2
Christchurch, NZ	2
BRNUlocation not on record	2
Tilburg, NL	2
Córdoba, ES	2
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Canadian Department of Agriculturelocation not on record	1
Paris, FR	1
Wellington, NZ	1
Granada, ES	1
Phyletisches Museum Jenalocation not on record	1
Corvallis, US	1
Alicante, ES	1
Pamplona, ES	1
Museo Achille Folettolocation not on record	1
Gijón, ES	1
Saint Louis, US	1
RJBJCIlocation not on record	1
Helsinki, FI	1
SLU Artdatabankenlocation not on record	1
Adam Mickiewicz University in Poznańlocation not on record	1
NoColllocation not on record	1
Conservatoire botanique national du Bassin parisienlocation not on record	1
MeiseBGlocation not on record	1

42 institutions · 409 of 418 vouchered records shown · 9 without an institution code

09Environmental DNA2 detections

Where the DNA of Arenaria montana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.6 °C 19.6–19.6

Seasonal swing summer↔winter16.6 °C

Max temp (day)25.2 °C

Min temp (night)12.7 °C

Precipitation33.6 mm/mo

Air humidity53.2 %

Moisture balance-124 mm/mo

Vapour deficit1,068 Pa

Wind speed2.40 m/s

Cloud cover35.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Arenaria montana

At a glance

Sources9 archives

Size & morphology2

Life cycle & reproduction3

Diet & foraging1

Habitat & environment7

Physiology & chemistry3

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type12 780 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions22 of 42 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type12 780 records