Aremonia agrimonoides

(L.) DC. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rosaceae/Aremonia

At a glance

Occurrence records1 079

Data sources7

Biological traits18

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Aremonia agrimonoides's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 079 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources18 traits

Occurrence & distributionGBIF1 079 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB · GoaT1.4 Gbp

01Narrative

Aremonia agrimonoides, commonly known as bastard-agrimony, is a herbaceous flowering plant in the rose family, Rosaceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTLEDATRY

Size & morphology4

Plant height0.242 m

⚠ sources differ — GIFT: 0.242 m · LEDA: 0.225 m · TRY: 0.23 m

Plant height generative0.225 m

Plant height max0.4 m

Plant height min0.05 m

Life cycle & reproduction6

Deciduousnessaestival

⚠ sources differ — TRY: aestival · GIFT: deciduous

Dispersal typeanimal

Flowering endJun

Flowering startMay

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Diaspore typefruit with appendage

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aremonia agrimonoides has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

The DNA barcodea real sequence read deposited for this species

ITSU90799.1 ↗598 bp

ACGT

TCGAAACCTGCCTGGCAGAACGACCCGAGAACACGTTTCAACGCTCGGGGGCGGAGGGCCTTCGCGGCCGCCCGTCCCCGCATCCCGGGA …

Aremonia agrimonioides internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence, and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Aremonia agrimonoides carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 422 890 204 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aremonia agrimonoides1.42 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 42 n = 21

Ploidy6× hexaploid · measured

Chromosome records42–422n range42median42mode9records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 429×GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl · CCDB · nw-europe-fl +1

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · slov-fl — Murín A. & Májovský J., 1987: Karyological study of the Slovak flora XIX. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 34 [1986]: 3-20.

CCDB · slov-fl — Murín A. & Májovský J., 1978: [Report], pp. 376-378. - In: Löve Á. (ed.), IOPB chromosome number reports LXI, Taxon 27 /4.

CCDB · slov-fl — Mičieta K., 2007: [New records in Acinos, Aremonia, Epipactis, Juncus, Ranunculus, Sparganium, Veronica, and Viola], pp. 63, 108, 240, 334, 336, 337, 340, 494, 559, 603, 621. - In: Marhold K., Mártonfi P., Mereďa P. jun., Mráz P. (eds), Chromosome number survey of the ferns and flowering plants of Slovakia. Veda, Bratislava.

CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2658

CCDB · ipcn-api-dl — Van Loon, J. C. & J. J. M. H. OUDEMANS. 1982. In IOPB chromosome number reports LXXV. Taxon 31: 343–344.

CCDB · ipcn-api-dl — Baltisberger, M. 1991. Cytological investigations of some Greek plants. Fl. Medit. 1: 157–173.

CCDB · ipcn-api-dl — Murín, A. & J. Májovský. 1987. Karyological study of the Slovak flora XIX. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 34: 3–20.

CCDB · ipcn-api-dl — Strid, A. & R. Franzen. 1981. In Chromosome number reports LXXIII. Taxon 30: 829–842.

2n 352×GoaT · Kew Plant DNA C-values Database · CCDB · kew

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · kew — Vidic T, Greilhuber J, Vilhar B, Dermastia M. 2009. Selective significance of genome size in a plant community with heavy metal pollution. Ecological Applications 19: 1515-1521.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

hexaploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

08Occurrence & distribution

Record type1 079 records

Wild obs. + sensor813

Museum / vouchered196

Cultivated / captive1

Other69

Origin

Introduced67

Range

Area of Occupancy AOO2 196 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy68% within 1 km

≤100 m 196≤1 km 98≤10 km 138

432 georeferenced · 381 without coordinates

Open the mapobservation + sensor813

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy74% within 1 km

≤100 m 6≤1 km 33≤10 km 14

53 georeferenced · 143 without coordinates

Open the institutions mapphysical evidence196

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Berlin, DE	53
LDlocation not on record	43
GJOlocation not on record	25
BRNUlocation not on record	19
Mlocation not on record	7
Salzburg, AT	5
Institut und Museum fuer Geologie und Palaeontologielocation not on record	5
BFLlocation not on record	4
MAlocation not on record	4
Wlocation not on record	4
BClocation not on record	3
Oskarshamn, SE	3
Xiamen, CN	3
inatura Erlebnis Naturschau GmbHlocation not on record	2
Görlitz, DE	2
Frankfurt am Main	2
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	2
PRClocation not on record	2
MeiseBGlocation not on record	1
Denver, US	1
Sede di Via Giorgio La Pira del Museo di Storia naturale di Firenze \| Via Giorgio La Pira headquarter of the Natural History Museum in Florencelocation not on record	1
Salamanca, ES	1
GZUlocation not on record	1
SLU Artdatabankenlocation not on record	1
South Kensington, GB	1
Provincia di Livornolocation not on record	1

26 institutions · 196 of 196 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aremonia agrimonoides

At a glance

Sources7 archives

Size & morphology4

Life cycle & reproduction6

Diet & foraging1

Habitat & environment5

Physiology & chemistry1

Other traits1

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type1 079 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions9 of 26 geolocated

Cultivated / Captivenot free-living

Record type1 079 records