Areca triandra

Roxb. ex Buch.-Ham. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Arecales/Arecaceae/Areca

At a glance

Occurrence records208

Data sources11

Biological traits30

DNA specimens9

eDNA detections9

Sources11 archives

Databases and archives Areca triandra's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility208 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources30 traits

Occurrence & distributionGBIF208 records

Environmental DNA1 datasets · 3 countries9 detections

DNA & barcodingBOLD · NCBI9 specimens

Genome at a glanceCCDB2n = 32

01Narrative

Areca triandra est une espèce de palmier du genre Areca originaire d'Inde et de Malaisie. Il est souvent utilisé comme plante ornementale et diffusé dans de nombreuses régions tropicales.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology10

Fruit length25 mm

Fruit width15 mm

Leaf length max2 000 mm

Leaf length min1 000 mm

Plant height4.75 m

Plant height max4 m

Plant height min3 m

Seed volume1 700 mm³

Seed volume max1 700 mm³

Seed volume min1 700 mm³

Life cycle & reproduction4

Deciduousnessevergreen

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit colourorange

Fruit fleshinessfleshy

Growth formtree

Habitat GIFTcanopy

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

Other traits6

Dbh max7 cm

Defenseno

Leaf spinesno

Plant support typefree-standing

Shoot length max600 cm

Shoot orientationerect

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Areca triandra has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes4

GenBank sequences10

eDNA detections9

Countries3

The DNA barcodea real sequence read deposited for this species

rbcLMK753941.1 ↗539 bpChina · 2016

ACGT

GCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTACGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCT …

Areca triandra voucher SCBG873 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL8★trnL-F★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Areca triandra carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Ploidydiploid inferred

Chromosome records32–322n range32median32mode12records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 3212×CCDB · ipcn-api-dl · CCDB · book-ipcn66 · CCDB · book-indian_vol2 +3

CCDB · ipcn-api-dl — Sarkar, A. K. 1987. Cytological assessment of Arenga Labill. and Areca L. of Palmae to ascertain their taxonomic affinities. Proc. Indian Sci. Congr. Assoc. 74(3,VI): 199–200.

CCDB · ipcn-api-dl — Röser, M. 1994. Pathways of karyological differentiation in palms. Pl. Syst. Evol. 189: 83–122.

CCDB · ipcn-api-dl — BAVAPPA, K. V. A., M. K. NAIR & M. J. RATNAMBAL. 1975. Karyotype studies in Areca catechu L., A. triandra Roxb. and A. catechu x A. triandra hybrids. Nucleus 18: 146–151.

CCDB · book-ipcn66 — Bavappa & Raman 1965

CCDB · book-indian_vol2 — Janaki Ammal, E.K. (D. 1945) ; Rawi (Delay, C. 1951) ; Sharma, A.K. & Sarkar, S.K. 1957a ; Bavappa, K.V.A. & Raman, V.S. 1965 ; Bavappa, K.V.A. et al. 1975 ; Bavappa, K.V .A. & Nair, M.K. 1978

CCDB · book-fedorov — Janaki Ammal

CCDB · book-fedorov — D. 1945)

CCDB · book-fedorov — Rawi (Delay 1951)

CCDB · book-fedorov — Shar)lla A. K., Sarkar 1957 lep

CCDB · book-fedorov — Ilavappa, Raman 1965 mu

CCDB · book-atlas-flowering-plants — Rawi, D. 1951

CCDB · Cave1958 — Sharma & Sarkar 1 957

n 162×CCDB · ipcn-api-dl · CCDB · book-ipcn66

CCDB · book-ipcn66 — Bavappa & Raman 1965

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type208 records

Wild obs. + sensor47

Museum / vouchered161

Origin

Introduced2

Range

Area of Occupancy AOO544 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 33≤1 km 7>10 km 3

43 georeferenced · 4 without coordinates

Open the mapobservation + sensor47

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 3>10 km 1

4 georeferenced · 157 without coordinates

Open the institutions mapphysical evidence161

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	43
Paris, FR	28
Bronx, US	27
Saint Louis, US	9
Moscow State Universitylocation not on record	8
Stockholm, SE	4
Tampa, US	3
South Kensington, GB	3
Campo Mourão, BR	2
Miami, US	2
Columbia, US	1
Plocation not on record	1
Universidad de Caldas (UCaldas)location not on record	1
LDlocation not on record	1

14 institutions · 133 of 161 vouchered records shown · 25 without an institution code

09Environmental DNA9 detections

Where the DNA of Areca triandra was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.0 °C 8.60–25.9

Seasonal swing summer↔winter5.60 °C

Max temp (day)20.8 °C 11.2–29.8

Min temp (night)15.1 °C 5.70–22.3

Precipitation218 mm/mo 80.7–343

Air humidity67.7 % 64.1–69.6

Moisture balance114 mm/mo 16.8–205

Vapour deficit741 Pa 423–1,012

Wind speed2.30 m/s 0.6–4.60

Cloud cover57.4 % 52.2–57.8

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)