Areas galactina

(van der Hoeven, 1840) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Areas

At a glance

Occurrence records617

Data sources7

Biological traits0

DNA specimens16

eDNA detections4

Sources7 archives

Databases and archives Areas galactina's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility617 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF617 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD16 specimens

01Narrative

Areas galactina is a moth of the family Erebidae. It was described by Jan van der Hoeven in 1840. It is found in China (Sichuan, Hunan, Guangdong, Guangxi, Yunnan, Hubei), Taiwan, the north-western Himalayas, India (Sikkim, Assam, Andamans), Nepal, Bhutan, Bangladesh, Indochina, the Philippines, Indonesia and Sundaland. The length of the forewings is 32–35 mm for males and 40–42 mm for females.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Areas galactina has left across the world's sequence archives.

At a glance

DNA specimens16

BINs5

Marker genes1

eDNA detections4

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 49 variable positions, in barcode order

5Cmostly conserved

22Tmostly conserved

50Tmostly conserved

64Tmostly conserved

76Amostly conserved

82Tmostly conserved

85Gvariable

97Tmostly conserved

133Tmostly conserved

181Gmostly conserved

187Tmostly conserved

202Tmostly conserved

214Amostly conserved

217Amostly conserved

235Tvariable

263Cmostly conserved

271Cvariable

284Tmostly conserved

319Avariable

322Gvariable

328Avariable

346Tmostly conserved

355Tmostly conserved

364Tmostly conserved

367Cvariable

370Avariable

373Amostly conserved

379Amostly conserved

397Tvariable

400Cmostly conserved

412Avariable

433Gmostly conserved

460Tvariable

478Cmostly conserved

487Tmostly conserved

514Amostly conserved

517Amostly conserved

533Cmostly conserved

541Tmostly conserved

553Avariable

556Amostly conserved

562Gvariable

571Tmostly conserved

601Tvariable

613Cvariable

619Tvariable

622Gmostly conserved

628Gvariable

643Tmostly conserved

AACACTATATTTTATTTTTGGTATTTGAGCAGGAATAGTTGGAACATCATTAAGAATATTAATTCGAGCAGAATTAGGAAATCCGGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.5%

Haplotypes9

BINs5

Most divergent pair4.1%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Spilosoma vaganssame family5.8%Spilosoma pteridissame family6.1%Spilosoma owgarrasame family6.7%Ocnogyna boeticumsame family6.8%Epatolmis luctiferasame family7.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type617 records

Wild obs. + sensor596

Museum / vouchered21

Range

Area of Occupancy AOO1 436 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 223≤1 km 119≤10 km 75>10 km 40

457 georeferenced · 139 without coordinates

Open the mapobservation + sensor596

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 3>10 km 3

6 georeferenced · 15 without coordinates

Open the institutions mapphysical evidence21

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
FACTlocation not on record	12
New Haven, US	4
Centre for Biodiversity Genomicslocation not on record	2
Zürich, CH	1
ZSMlocation not on record	1
Provincia di Livornolocation not on record	1

6 institutions · 21 of 21 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Areas galactina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.8 °C 19.5–24.0

Seasonal swing summer↔winter1.70 °C

Max temp (day)23.4 °C 22.7–27.4

Min temp (night)16.0 °C 16.0–20.3

Precipitation349 mm/mo 284–350

Air humidity70.0 % 66.1–71.0

Moisture balance232 mm/mo 166–241

Vapour deficit737 Pa 652–961

Wind speed0.9 m/s 0.6–1.20

Cloud cover49.2 % 46.8–65.1

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)