Ardozyga catarrhacta

(Meyrick, 1904) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Gelechiidae/Ardozyga

At a glance

Occurrence records105

Data sources8

Biological traits0

DNA specimens123

eDNA detections125

Sources8 archives

Databases and archives Ardozyga catarrhacta's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility105 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI125 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics123 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF105 records

Environmental DNA1 datasets · 1 countries125 detections

DNA & barcodingBOLD123 specimens

01Narrative

Ardozyga catarrhacta is a species of moth in the family Gelechiidae. It was described by Edward Meyrick in 1904. It is found in Australia, where it has been recorded from New South Wales. The wingspan is about . The forewings are shining whitish-ochreous with five oblique dark fuscous marks or spots on the costa, the basal minute, the others larger posteriorly, last two confluent. There is a broad dark fuscous dorsal streak from the base to the tornus, with the extremities pointed and the upper edge projecting at one-fourth and more strongly at two-thirds. There is also a dark fuscous spot along the termen beneath the apex. The hindwings are whitish-grey.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding123 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ardozyga catarrhacta has left across the world's sequence archives.

At a glance

DNA specimens123

BINs2

Marker genes2

eDNA detections125

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus112 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 36 variable positions, in barcode order

16Cvariable

43Tmostly conserved

79Avariable

92Tvariable

100Tvariable

130Tvariable

133Tmostly conserved

154Cvariable

181Avariable

202Tmostly conserved

205Tvariable

212Tmostly conserved

259Tvariable

263Cvariable

271Cvariable

274Cvariable

283Cvariable

287Tmostly conserved

361Cvariable

391Tvariable

397Cvariable

400Tmostly conserved

401Cvariable

403Tvariable

484Avariable

520Tvariable

529Tvariable

533Cvariable

538Cvariable

557Cvariable

596Tmostly conserved

604Tvariable

610Cvariable

613Tvariable

616Tvariable

625Avariable

AACTTTATATTTTATCTTTGGAATTTGAGCAGGTATAGTTGGTACATCTCTTAGTTTATTAATTCGTGCTGAATTAGGAAATCCTGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.4%

Haplotypes16

BINs2

Most divergent pair5.2%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ardozyga xuthiassame genus5.6%Ardozyga mesochrasame genus5.9%Ardozyga obeliscotasame genus6.4%Ardozyga chalazodessame genus6.4%Ardozyga stratiferasame genus6.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type105 records

Wild obs. + sensor98

Museum / vouchered7

Range

Area of Occupancy AOO216 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 61≤1 km 14≤10 km 3>10 km 4

82 georeferenced · 16 without coordinates

Open the mapobservation + sensor98

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 7 records without

Open the institutions mapphysical evidence7

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Australian National Insect Collectionlocation not on record	1

1 institutions · 1 of 7 vouchered records shown · 6 without an institution code

09Environmental DNA125 detections

Where the DNA of Ardozyga catarrhacta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found125

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 125 detections have coordinates

Open the map1 country0

Dry Sclerophyll Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.5 °C 19.7–24.2

Seasonal swing summer↔winter12.6 °C

Max temp (day)25.2 °C 23.8–30.7

Min temp (night)15.9 °C 14.1–22.1

Precipitation28.3 mm/mo 14.0–179

Air humidity49.9 % 46.5–62.0

Moisture balance-75.0 mm/mo

Vapour deficit1,224 Pa 1,033–1,523

Wind speed3.70 m/s

Cloud cover19.9 % 13.0–31.0

CHELSA 1981–2010, ~9 km grid, at location & month of 125 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)