Ardozyga amblopis

(Meyrick, 1904) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Gelechiidae/Ardozyga

At a glance

Occurrence records45

Data sources7

Biological traits0

DNA specimens66

eDNA detections52

Sources7 archives

Databases and archives Ardozyga amblopis's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility45 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI52 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics66 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF45 records

Environmental DNA1 datasets · 1 countries52 detections

DNA & barcodingBOLD66 specimens

01Narrative

Ardozyga amblopis is a species of moth in the family Gelechiidae. It was described by Edward Meyrick in 1904. It is found in Australia, where it has been recorded from Western Australia. The wingspan is about . The forewings are whitish, densely irrorated (speckled) with dark fuscous and with indistinct blackish spots along the costa, alternating with smaller pale reddish-ochreous spots, and edged beneath with irregular ferruginous spots. There are elongate blackish spots in the disc before and beyond the middle, separated by a pale reddish-ochreous spot. There is also a blackish streak along the fold, interrupted by a pale reddish-ochreous spot in the middle and there is some undefined pale reddish-ochreous suffusion towards the apex. The hindwings are fuscous, with an irregular transparent basal patch.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding66 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ardozyga amblopis has left across the world's sequence archives.

At a glance

DNA specimens66

BINs2

Marker genes2

eDNA detections52

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P636 bp consensus54 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 46 variable positions, in barcode order

33Amostly conserved

39Cmostly conserved

69Cmostly conserved

78Amostly conserved

99Tmostly conserved

126Tmostly conserved

132Amostly conserved

141Tmostly conserved

162Amostly conserved

211Cmostly conserved

219Tmostly conserved

225Tmostly conserved

258Cmostly conserved

261Gmostly conserved

265Tmostly conserved

270Amostly conserved

282Amostly conserved

324Amostly conserved

357Tmostly conserved

363Tmostly conserved

381Tmostly conserved

399Tmostly conserved

402Cmostly conserved

405Cmostly conserved

414Tmostly conserved

427Tmostly conserved

432Amostly conserved

456Tmostly conserved

476Gmostly conserved

478Cmostly conserved

480Tmostly conserved

489Tmostly conserved

507Amostly conserved

528Amostly conserved

529Tmostly conserved

540Tmostly conserved

541Tmostly conserved

549Gmostly conserved

561Gmostly conserved

579Cmostly conserved

594Tvariable

595Cvariable

597Tvariable

600Tvariable

612Tmostly conserved

627Amostly conserved

ACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTCGGTACATCTCTTAGTTTATTAATTCGTGCCGAATTAGGAAATCCTGGCTCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.4%

Haplotypes8

BINs2

Most divergent pair7.2%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ardozyga xuthiassame genus6.0%Ardozyga aversellasame genus6.3%Ardozyga enchotypasame genus6.4%Ardozyga obeliscotasame genus7.1%Ardozyga hormodessame genus7.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type45 records

Wild obs. + sensor40

Museum / vouchered5

Range

Area of Occupancy AOO144 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 18≤1 km 5

23 georeferenced · 17 without coordinates

Open the mapobservation + sensor40

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 5 records without

Open the institutions mapphysical evidence5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Centre for Biodiversity Genomicslocation not on record	1

1 institutions · 1 of 5 vouchered records shown · 4 without an institution code

09Environmental DNA52 detections

Where the DNA of Ardozyga amblopis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found52

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 52 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.9 °C 19.8–24.5

Seasonal swing summer↔winter11.5 °C

Max temp (day)30.7 °C 24.6–30.7

Min temp (night)17.6 °C 14.7–18.4

Precipitation14.9 mm/mo 12.1–35.6

Air humidity49.9 % 49.9–53.8

Moisture balance-179 mm/mo -189–-67.4

Vapour deficit1,507 Pa 1,051–1,542

Wind speed3.40 m/s 2.40–3.60

Cloud cover12.2 % 9.90–18.5

CHELSA 1981–2010, ~9 km grid, at location & month of 52 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)