Ardisia crenata
Sims · speciesAt a glance
Occurrence records15 818
Data sources11
Biological traits60
DNA specimens71
eDNA detections54
Sources11 archives
Databases and archives Ardisia crenata's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility15 818 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI54 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics71 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
GoaTGenomes on a Tree · Sangergenome ~2.59 Gbp↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources60 traits
Chemical compositionLOTUS · NPASS52 compounds
Occurrence & distributionGBIF15 818 records
Environmental DNA2 datasets · 4 countries54 detections
DNA & barcodingBOLD · NCBI71 specimens
Genome at a glanceGoaT2.6 Gbp
01Narrative
Ardisia crenata, l'Ardisie crénelée ou Baie corail, est une espèce de plantes à fleurs dicotylédones de la famille des Primulaceae, sous-famille des Myrsinoideae, originaire d'Asie de l'Est et du Sud. C'est une plante de sous-bois qui pousse dans des régions tropicales et subtropicales. Cultivée, elle est généralement plantée à l'extérieur. Elle est aussi dans brawl Stars et permet de gagner de l'Xp.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsTRY
Size & morphology23
Fruit length7 mm
Fruit width7 mm
Inflorescence length max16 cm
Inflorescence length min4 cm
Leaf length85 mm
Leaf length max150 mm
Leaf length min45 mm
Leaf size1 125 mm²
Leaf width27.5 mm
⚠ sources differ — AusTraits: 27.5 mm · GIFT: 30 mm
Leaf width max40 mm
Leaf width min12 mm
Petiole length0.8 cm
Plant height1.42 m
⚠ sources differ — GIFT: 1.42 m · AusTraits: 2 m · TRY: 1.15 m
Plant height max3 m
Plant height min0.5 m
Seed length6 mm
Seed mass134 mg
⚠ sources differ — TRY: 134 mg · GIFT: 221 mg
Seed mass max221 mg
Seed mass min221 mg
Seed volume99 mm³
Seed volume max99 mm³
Seed volume min99 mm³
Seed width5.5 mm
Life cycle & reproduction8
Deciduousnessevergreen
Dispersal typeanimal
Flowering startDec
Flowering timeyyyyynnnnnyy
Life formshrub
Life spanperennial
Raunkiær life formphanerophyte
Sex typehermaphrodite
Diet & foraging1
Parasiteindependent
Habitat & environment15
Aquaticterrestrial
Climatesubtropical
Climberself-supporting
Elevation max2 400 m
Elevation mean1 098 m
Elevation min90 m
Epiphyteterrestrial
Fruit fleshinessfleshy
Fruit typedrupe
Growth formshrub
Leaf compoundnesssimple
Leaf formelliptic-lanceolate
Leaf shapeelliptical lanceolate oblanceolate ovate
Mycorrhiza type0.000000243
Woodinesswoody
Physiology & chemistry8
Leaf C:N ratio34.72 g/g
Leaf c474 mg/g
Leaf dry-matter content (LDMC)309 mg/g
Leaf n19.22 mg/g
Leaf p0.87 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Specific leaf area (SLA)11.39 mm²/mg
⚠ sources differ — TRY: 11.39 mm²/mg · GIFT: 17.72 mm²/mg
Other traits5
Leaf margincrenate
Leaf spinesno
Leaf thornsno
Sla max17.72 mm²/mg
Sla min17.72 mm²/mg
03Chemical composition52 compounds
Compounds documented for Ardisia crenata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Oleanane triterpenoids40
Isocoumarins6
Benzoquinones4
Eremophilane sesquiterpenoids4
Disaccharides $ Polysaccharides1
Documented compounds52 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (1S,2R,4S,5R,8R,10S,13R,14R,17S,18R,20S)-10-[(2R,3S,4R,5R)-5-[(2S,3R,4S,5S,6R)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(2S,3S,4S,5S,6R)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxy-4-hydroxy-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-2-hydroxy-4,5,9,9,13,20-hexamethyl-24-oxahexacyclo[15.5.2.01,18.04,17.05,14.08,13]tetracosane-20-carbaldehyde | present | LOTUS | |
| (1S,2R,4S,5R,8R,10S,13R,14R,17S,18R,20S)-10-[(2R,3S,4R,5R)-5-[(2S,3R,4S,5S,6R)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(2S,3S,4S,5S,6R)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxy-4-hydroxy-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-2-hydroxy-4,5,9,9,13,20-hexamethyl-24-oxahexacyclo[15.5.2.01,18.04,17.05,14.08,13]tetracosane-20-carboxylic acid | present | LOTUS | |
| (1S,2R,4S,5R,8R,10S,13R,14R,17S,18R,20S)-10-[(2R,3S,4S,5R)-5-[(2S,3R,4S,5S,6R)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxyoxan-2-yl]oxy-3,4-dihydroxyoxan-2-yl]oxy-2-hydroxy-4,5,9,9,13,20-hexamethyl-24-oxahexacyclo[15.5.2.01,18.04,17.05,14.08,13]tetracosane-20-carbaldehyde | present | LOTUS | |
| (1S,2R,4S,5R,8R,10S,13R,14R,17S,18R,20S)-10-[(2R,3S,4S,5R)-5-[(2S,3R,4S,5S,6R)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(2S,3S,4S,5S,6R)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxy-3,4-dihydroxyoxan-2-yl]oxy-2-hydroxy-4,5,9,9,13,20-hexamethyl-24-oxahexacyclo[15.5.2.01,18.04,17.05,14.08,13]tetracosane-20-carbaldehyde | present | LOTUS | |
| (1S,2R,4S,5R,8R,10S,13R,14R,17S,18R,20S)-2-hydroxy-10-[(2R,3S,4R,5R)-4-hydroxy-3,5-bis[[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy]oxan-2-yl]oxy-4,5,9,9,13,20-hexamethyl-24-oxahexacyclo[15.5.2.01,18.04,17.05,14.08,13]tetracosane-20-carbaldehyde | present | LOTUS | |
| (2S,3S,4S,5R,6R)-6-[(2R)-3-[(2S,4aS,5R,6aR,6aS,6bR,8aR,10S,12aR,14bS)-10-[(2R,3S,4R,5R)-5-[(2S,3R,4S,5S,6R)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(2S,3S,4S,5S,6R)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxy-4-hydroxy-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-5-hydroxy-4a-(hydroxymethyl)-2,6a,6b,9,9,12a-hexamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-2-carbonyl]oxy-2-hydroxypropoxy]-3,4,5-trihydroxyoxane-2-carboxylic acid | present | LOTUS | |
| (2S,3S,4S,5S,6R)-2-[(2S,3R,4S,5S,6R)-4,5-dihydroxy-2-[(3R,4R,5S,6R)-4-hydroxy-6-[[(1S,2R,4S,5R,8R,10S,13R,14R,17S,18R,20S)-2-hydroxy-20-(hydroxymethyl)-4,5,9,9,13,20-hexamethyl-24-oxahexacyclo[15.5.2.01,18.04,17.05,14.08,13]tetracosan-10-yl]oxy]-5-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-3-yl]oxy-6-(hydroxymethyl)oxan-3-yl]oxy-6-methyloxane-3,4,5-triol | present | LOTUS | |
| (2S,4aS,5R,6aR,6aS,6bR,8aR,10S,12aR,14bS)-10-[(2S,3R,4S,5S)-5-[(2S,3R,4S,5S,6R)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxy-4-hydroxy-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-5-hydroxy-4a-(hydroxymethyl)-2,6a,6b,9,9,12a-hexamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-2-carboxylic acid | present | LOTUS | |
| 10-[5-[4,5-Dihydroxy-6-(hydroxymethyl)-3-(3,4,5-trihydroxy-6-methyloxan-2-yl)oxyoxan-2-yl]oxy-4-hydroxy-3-[3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-2-hydroxy-4,5,9,9,13,20-hexamethyl-23-oxo-24-oxahexacyclo[15.5.2.01,18.04,17.05,14.08,13]tetracosane-20-carbaldehyde | present | LOTUS | |
| 10-[5-[4,5-Dihydroxy-6-(hydroxymethyl)-3-(3,4,5-trihydroxy-6-methyloxan-2-yl)oxyoxan-2-yl]oxy-4-hydroxy-3-[3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-2-hydroxy-4,5,9,9,13,20-hexamethyl-24-oxahexacyclo[15.5.2.01,18.04,17.05,14.08,13]tetracosane-20-carbaldehyde | present | LOTUS |
05DNA & barcoding71 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ardisia crenata has left across the world's sequence archives.
At a glance
DNA specimens71
Marker genes6
GenBank sequences10
eDNA detections54
Countries5
The DNA barcodea real sequence read deposited for this species
TAAAGCAGGTACTGGATTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGAGTATGTAACCAAGGATACTGATATTTT …
Ardisia crenata voucher M129 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL8★trnL-F★ITS★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceGoaT
The complete instruction manual Ardisia crenata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size2 591 700 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Ardisia crenata2.59 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
08Occurrence & distribution
Record type15 818 records
Wild obs. + sensor12 477
Museum / vouchered3 320
Cultivated / captive4
Other17
Origin
Native20
Introduced189
Range
Area of Occupancy AOO19 268 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy70% within 1 km
≤100 m 5 116≤1 km 833≤10 km 1 628>10 km 932
8 509 georeferenced · 3 968 without coordinates
Open the mapobservation + sensor12 477
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy59% within 1 km
≤100 m 66≤1 km 35≤10 km 61>10 km 10
172 georeferenced · 3 148 without coordinates
Open the institutions mapphysical evidence3 320
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 4 records without
Open the mapnot free-living4
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions92 of 170 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Beijing, CN | 374 |
| Guangzhou, CN | 256 |
| Kunming, CN | 185 |
| Nanjing, CN | 168 |
| Nishihara, JP | 167 |
| Odawara, JP | 148 |
| Guilin, CN | 145 |
| Taipei, TW | 73 |
| Taipei, TW | 72 |
| Tsukuba, JP | 63 |
| Wuhan, CN | 62 |
| Bando, JP | 61 |
| Chiba, JP | 59 |
| Xiamen, CN | 57 |
| Yangling, CN | 54 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 52 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 51 |
| Taipei, TW | 51 |
| Hangzhou, CN | 47 |
| Jena Microbial Resource Collectionlocation not on record | 41 |
| Kochi, JP | 40 |
| Brisbane, AU | 39 |
| Saint Louis, US | 39 |
| Sanda, JP | 39 |
| Tampa, US | 34 |
| Smithfield, AU | 29 |
| Nanjing, CN | 28 |
| Nagano City, JP | 26 |
| Zhejiang Universitylocation not on record | 24 |
| Kew, GB | 22 |
| Zhuzhou, CN | 22 |
| Shanghai, CN | 22 |
| FJFClocation not on record | 21 |
| Strecker Museum, Baylor Universitylocation not on record | 20 |
| Changsha, CN | 19 |
| TAIElocation not on record | 18 |
| Chengdu, CN | 18 |
| Seoul, KR | 17 |
| Tokushima, JP | 16 |
| Nishihara, JP | 15 |
| Guangzhou, CN | 15 |
| Central China Normal Universitylocation not on record | 14 |
| Zhejiang Museum of Natural Historylocation not on record | 14 |
| Toyama, JP | 14 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 12 |
| Paris, FR | 12 |
| Kawasaki Shi Tama Ku, JP | 12 |
| Sagamihara, JP | 12 |
| Shanghai, CN | 12 |
| Durban, ZA | 11 |
| NSMKlocation not on record | 10 |
| Valdosta State Universitylocation not on record | 10 |
| Guiyang, CN | 10 |
| Nagatoro-machi, Chichibu-gun, JP | 10 |
| Awka, NG | 9 |
| KURAlocation not on record | 9 |
| Kagoshima, JP | 9 |
| Mount Annan, AU | 9 |
| EMTCMlocation not on record | 9 |
| Sendai, JP | 9 |
| Osaka, JP | 8 |
| Guizhou Forestry Schoollocation not on record | 7 |
| FJIDClocation not on record | 7 |
| US | 7 |
| KR | 7 |
| Yunnan Universitylocation not on record | 6 |
| Miami, US | 6 |
| Anhui Normal Universitylocation not on record | 6 |
| Wuhan, CN | 6 |
| Pretoria, ZA | 6 |
| Blumenau, BR | 6 |
| Forestry and Forest Products Research Institutelocation not on record | 5 |
| Herbarium of South China Botanical Gardenlocation not on record | 5 |
| Fujian Institute of Subtropical Botanylocation not on record | 5 |
| Museo Entomologico de Leonlocation not on record | 5 |
| Tomioka, JP | 5 |
| Beijing, CN | 4 |
| Jishou Universitylocation not on record | 4 |
| FFPRIlocation not on record | 4 |
| Xian, CN | 4 |
| Edinburgh, GB | 4 |
| University of Stellenboschlocation not on record | 4 |
| Elocation not on record | 4 |
| HUFDlocation not on record | 4 |
| 云南省思茅市民族传统医药研究所location not on record | 4 |
| Chengdu, CN | 4 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 4 |
| Xinxiang, CN | 3 |
| Honolulu, US | 3 |
| nlocation not on record | 3 |
| Fort Worth, US | 3 |
| Nanjing, CN | 3 |
| J.F.Oberlin Universitylocation not on record | 3 |
| Nagasaki University - Fisherieslocation not on record | 3 |
| National Institute of Biological Resourceslocation not on record | 3 |
| Parthenon Tama History Museumlocation not on record | 3 |
| Canberra, AU | 3 |
| Berlin, DE | 3 |
| Stockholm, SE | 3 |
| Guiyang, CN | 3 |
| James Cook Townsvillelocation not on record | 3 |
| Xian, CN | 3 |
| Jiujiang Forestry Institutelocation not on record | 3 |
| Nanchong, CN | 3 |
| BISHlocation not on record | 3 |
| Plocation not on record | 3 |
| ASUlocation not on record | 3 |
| Zhengzhou, CN | 3 |
| GAlocation not on record | 2 |
| Philadelphia, US | 2 |
| Columbia, US | 2 |
| Shinshu Universitylocation not on record | 2 |
| Canadian Department of Agriculturelocation not on record | 2 |
| Jackson, US | 2 |
| Armidale, AU | 2 |
| Clemson, US | 2 |
| Auckland, NZ | 2 |
| Austin, US | 2 |
| Chongqing Museumlocation not on record | 2 |
| DNSMlocation not on record | 2 |
| BAYLUlocation not on record | 2 |
| Universidad de Caldas (UCaldas)location not on record | 2 |
| Criciúma, BR | 2 |
| Minia, EG | 2 |
| LDlocation not on record | 2 |
| Jiangxi College of Traditional Chinese Medicinelocation not on record | 2 |
| JGSlocation not on record | 2 |
| UNESClocation not on record | 2 |
| Guiyang, CN | 2 |
| Denver, US | 2 |
| McWane Science Centerlocation not on record | 2 |
| Universidade da Região de Joinville - Univillelocation not on record | 1 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 1 |
| Moscow State Universitylocation not on record | 1 |
| Xining, CN | 1 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 1 |
| Department of National Parks, Wildlife and Plant Conservationlocation not on record | 1 |
| Fukushima Universitylocation not on record | 1 |
| 黔东南州民族医药研究所标本室location not on record | 1 |
| Cambridge, US | 1 |
| Tall Timbers Research Stationlocation not on record | 1 |
| CJBGlocation not on record | 1 |
| Richmond, US | 1 |
| Herbarium of the Kyushu University Museum (FU)location not on record | 1 |
| Florida Museum of Natural Historylocation not on record | 1 |
| Peking Universitylocation not on record | 1 |
| UNIVILLElocation not on record | 1 |
| Nanyue Arboretumlocation not on record | 1 |
| Chongqing Natural History Museumlocation not on record | 1 |
| Dekalb, US | 1 |
| BKF, BKlocation not on record | 1 |
| Durango, MX | 1 |
| UFMGlocation not on record | 1 |
| Jinghong, CN | 1 |
| Durham, US | 1 |
| Southwest Forestry Collegelocation not on record | 1 |
| Chengdu, CN | 1 |
| Seychelles National Herbariumlocation not on record | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| HAWlocation not on record | 1 |
| Mie Prefectural Museumlocation not on record | 1 |
| Jardín Botánico José Celestino Mutis (JBBJCM)location not on record | 1 |
| Little Rock, US | 1 |
| Bangkok, TH | 1 |
| JBRJlocation not on record | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| Bronx, US | 1 |
| Antiguo Cuscatlán, SV | 1 |
| MeiseBGlocation not on record | 1 |
| USP-IBlocation not on record | 1 |
170 institutions · 3 205 of 3 320 vouchered records shown · 112 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA54 detections
Where the DNA of Ardisia crenata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found54
Studies independent surveys2
Countries4
Verifiable raw sequence linked1
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 54 detections have coordinates
Open the map4 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median19.8 °C 9.50–25.0
Seasonal swing summer↔winter18.3 °C
Max temp (day)22.7 °C 11.9–27.6
Min temp (night)15.8 °C 7.00–21.8
Precipitation316 mm/mo 111–424
Air humidity66.0 % 59.1–67.4
Moisture balance229 mm/mo
Vapour deficit778 Pa 486–1,103
Wind speed3.10 m/s
Cloud cover47.8 % 40.0–52.4
CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.