Ardeadoris angustolutea

(Rudman, 1990) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Nudibranchia/Chromodorididae/Ardeadoris

At a glance

Occurrence records449

Data sources8

Biological traits2

DNA specimens5

eDNA detections5

Sources8 archives

Databases and archives Ardeadoris angustolutea's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility371 records↗

OBISOcean Biodiversity Information System78 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS449 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD5 specimens

01Narrative

Ardeadoris angustolutea is a species of colourful sea slug, a dorid nudibranch, a shell-less marine gastropod mollusc in the family Chromodorididae.Caballer, M.; Bouchet, P. (2015). Ardeadoris angustolutea (Rudman, 1990). In: MolluscaBase (2015). Accessed through: World Register of Marine Species on 2015-11-20 It was transferred to the genus Ardeadoris on the basis of DNA evidence.Johnson R.F. & Gosliner T.M. (2012) Traditional taxonomic groupings mask evolutionary history: A molecular phylogeny and new classification of the chromodorid nudibranchs. PLoS ONE 7(4): e33479

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ardeadoris angustolutea has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

eDNA detections5

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

121Avariable

139Tvariable

142Cmostly conserved

181Cmostly conserved

268Amostly conserved

460Cvariable

463Cvariable

500Cmostly conserved

538Tmostly conserved

544Avariable

577Gmostly conserved

AACTTTATATATGTTCCTTGGAATATGATGTGGACTGGTTGGTACCGGTCTAAGTTTATTGATTCGTTTTGAGTTGGGAACTGCTGGGGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.82%

Haplotypes3

BIN1

Most divergent pair1.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Felimida luteoroseasame family16.1%Glossodoris cinctasame family16.3%Triopha catalinaesame order16.9%Atalodoris sparsasame order16.9%Glossodoris hikuerensissame family17.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type449 records

Wild obs. + sensor393

Museum / vouchered56

Range

Area of Occupancy AOO680 km²

Depth

0–200 m sunlit65

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 12 m · max 25 m · 65 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 141≤1 km 142≤10 km 36>10 km 44

363 georeferenced · 30 without coordinates

Open the mapobservation + sensor393

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤1 km 10≤10 km 10>10 km 4

24 georeferenced · 32 without coordinates

Open the institutions mapphysical evidence56

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CASlocation not on record	19
Sydney, AU	6
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
Washington, US	2
WoRMS Editorial Boardlocation not on record	1

5 institutions · 30 of 56 vouchered records shown · 2 without an institution code

09Environmental DNA5 detections

Where the DNA of Ardeadoris angustolutea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

outer reef slope

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.6 °C 17.4–23.6

Seasonal swing summer↔winter3.30 °C

Max temp (day)25.0 °C 21.7–25.0

Min temp (night)22.4 °C 14.7–22.4

Precipitation50.7 mm/mo 50.7–61.6

Air humidity59.7 % 57.5–59.7

Vapour deficit1,166 Pa 873–1,166

Cloud cover33.5 % 33.5–34.9

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)