Arctozenus risso

(Bonaparte, 1840) · species

image placeholder — illustration coming later

Animalia/Chordata/Aulopiformes/Paralepididae/Arctozenus

At a glance

Occurrence records21 927

Data sources12

Biological traits7

DNA specimens75

eDNA detections54

Sources12 archives

Databases and archives Arctozenus risso's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility8 171 records↗

OBISOcean Biodiversity Information System13 756 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI54 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics75 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS21 927 records

Environmental DNA3 datasets · 5 countries54 detections

DNA & barcodingBOLD75 specimens

Genome at a glanceGoaT · NCBI≈2 Gbp

01Narrative

Arctozenus risso, the Spotted barracudina or Ribbon barracudina, is a species of barracudina found in oceans worldwide in the meso- and bathypelagic zone down to abound 2200 m. This species grows to a length of 30 cm SL. This species is the only known member of its genus. It is an important forage species for many pelagic predators, such as cephalopods, common dolphins, and albacore.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length30 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebathypelagic

Uses & economy1

Commercial importanceof no interest

Other traits3

Depth max2 200 m

Depth min0 m

Vulnerability26.6

05DNA & barcoding75 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arctozenus risso has left across the world's sequence archives.

At a glance

DNA specimens75

BINs6

Marker genes2

eDNA detections54

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus67 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Where individuals differ — all 57 variable positions, in barcode order

22Tmostly conserved

31Amostly conserved

55Avariable

58Avariable

64Gmostly conserved

70Avariable

97Tmostly conserved

112Tmostly conserved

118Cvariable

124Amostly conserved

145Amostly conserved

160Tmostly conserved

163Amostly conserved

166Tmostly conserved

167Avariable

178Cmostly conserved

184Tmostly conserved

199Cvariable

205Gvariable

211Tvariable

244Tmostly conserved

265Gmostly conserved

268Cvariable

289Amostly conserved

295Tvariable

322Gvariable

334Gvariable

367Tmostly conserved

370Amostly conserved

385Gmostly conserved

388Tvariable

427Amostly conserved

430Tmostly conserved

436Cvariable

439Tmostly conserved

451Tvariable

457Cvariable

460Tmostly conserved

463Gmostly conserved

469Amostly conserved

475Avariable

478Cvariable

484Amostly conserved

490Gmostly conserved

502Cmostly conserved

511Avariable

514Amostly conserved

529Amostly conserved

532Cvariable

571Gmostly conserved

589Avariable

598Tmostly conserved

622Cmostly conserved

628Amostly conserved

631Cvariable

640Amostly conserved

652Amostly conserved

CCTCTACCTGTTATTTGGTGCTTGGGCCGGAATAGTGGGCACAGCGTTAAGCCTACTAATTCGGGCAGAACTAAGCCAGCCCGGAGCCCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 42 variants.

Diversity (π)3.7%

Haplotypes42

BINs6

Most divergent pair16.3%

N.AmericaOtherOceaniaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Paralepis coregonoidessame family12.9%Paralepis brevirostrissame family14.9%Sudis hyalinasame family15.6%Channa asiaticasame order16.3%Ichthyococcus ovatussame order17.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCYTB

animal barcodemitochondrial

06Genome at a glanceGoaT · NCBI

The complete instruction manual Arctozenus risso carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 950 702 363 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Arctozenus risso1.95 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type21 927 records

Wild obs. + sensor16 084

Museum / vouchered3 705

Other2 138

Origin

Native18

Range

Area of Occupancy AOO35 744 km²

Depth

0–200 m sunlit2 332

200–1000 m twilight6 886

1–4 km midnight475

>4 km abyssal1

median 317.4 m · max 5 340 m · 9 694 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 6 415≤1 km 760≤10 km 5>10 km 16

7 196 georeferenced · 8 888 without coordinates

Open the mapobservation + sensor16 084

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 8≤1 km 137≤10 km 37>10 km 199

381 georeferenced · 3 324 without coordinates

Open the institutions mapphysical evidence3 705

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 40 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
The Atlantic reference Centrelocation not on record	620
FishBaselocation not on record	589
University of California San Diegolocation not on record	93
Bergen, NO	84
Washington, US	43
Paris, FR	39
ICATMARlocation not on record	37
Toronto, CA	30
Copenhagen, DK	26
NHMOlocation not on record	18
UWFClocation not on record	16
Australian National Fish Collectionlocation not on record	16
North Carolina Museum of Natural Scienceslocation not on record	14
New Haven, US	14
Maurice Lamontagne Institutelocation not on record	8
University of Washington, Fish Collectionlocation not on record	7
CASlocation not on record	6
Museums Victorialocation not on record	6
Sydney, AU	5
IEO-COMA-CSIClocation not on record	4
Cambridge, US	4
50location not on record	4
Wuzhou, CN	3
Stockholm, SE	3
Oregon State Universitylocation not on record	2
Los Angeles, US	2
Tromsø, NO	2
ICM-CSIClocation not on record	2
SNSB-Zoologische Staatssammlung Münchenlocation not on record	2
Centro Interdisciplinario de Ciencias Marinas, Instituto Politécnico Nacionallocation not on record	1
South Kensington, GB	1
Edmonton, CA	1
Frankfurt am Main	1
Royal British Columbia Museumlocation not on record	1
University of Copenhagen, Natural History Museum of Denmark, Zoological Museumlocation not on record	1
CSIRO, Australian National Fish Collectionlocation not on record	1
ICMlocation not on record	1
Moore Laboratory of Zoology, Occidental Collegelocation not on record	1
	1
Tapachula, MX	1

40 institutions · 1 710 of 3 705 vouchered records shown · 42 without an institution code

09Environmental DNA54 detections

Where the DNA of Arctozenus risso was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found54

Studies independent surveys3

Countries5

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 54 detections have coordinates

Open the map5 countries0

Sea bottomPacific Ocean

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.80 °C 0.6–17.3

Seasonal swing summer↔winter16.3 °C

Max temp (day)9.60 °C 1.90–18.5

Min temp (night)7.80 °C -0.1–16.4

Precipitation100 mm/mo 28.9–129

Air humidity68.8 % 63.0–76.4

Vapour deficit390 Pa 216–691

Cloud cover52.8 % 39.3–77.3

CHELSA 1981–2010, ~9 km grid, at location & month of 42 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Arctozenus risso

At a glance

Sources12 archives

Size & morphology1

Habitat & environment2

Uses & economy1

Other traits3

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type21 927 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions17 of 40 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type21 927 records