Arctotis revoluta

Jacq. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Arctotis

At a glance

Occurrence records79

Data sources10

Biological traits12

DNA specimens3

eDNA detections3

Sources10 archives

Databases and archives Arctotis revoluta's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility79 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources12 traits

Chemical compositionLOTUS · NPASS11 compounds

Occurrence & distributionGBIF79 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Arctotis candida là một loài thực vật có hoa trong họ Cúc. Loài này được Thunb. mô tả khoa học đầu tiên năm 1823.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Size & morphology2

Plant height max1.2 m

Plant height min0.05 m

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climberself-supporting

Elevation max1 450 m

Elevation min0 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition11 compounds

Compounds documented for Arctotis revoluta across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Guaiane sesquiterpenoids4

Oleanane triterpenoids4

Germacrane sesquiterpenoids2

Flavonols1

Documented compounds11 total

Tissue Source Quantified only

Compound	Amount	Source
(3aS,6aR,9S,9aR,9bR)-9-methyl-3,6-dimethylidene-3a,4,5,6a,7,9,9a,9b-octahydroazuleno[4,5-b]furan-2,8-dione	present	LOTUS
(3aS,6E,10Z,11aR)-6-methyl-3-methylidene-2-oxo-3a,4,5,8,9,11a-hexahydrocyclodeca[b]furan-10-carboxylic acid	present	LOTUS
(3aS,6Z,10E,11aS)-6-methyl-3-methylidene-2-oxo-3a,4,5,8,9,11a-hexahydrocyclodeca[b]furan-10-carboxylic acid	present	LOTUS
(3R,3aS,6aR,9S,9aR,9bS)-3,9-dimethyl-6-methylidene-3a,4,5,6a,7,9,9a,9b-octahydro-3H-azuleno[4,5-b]furan-2,8-dione	present	LOTUS
(3S,3aS,6aR,9S,9aR,9bS)-3,9-dimethyl-6-methylidene-3a,4,5,6a,7,9,9a,9b-octahydro-3H-azuleno[4,5-b]furan-2,8-dione	present	LOTUS
(3S,4aR,6aR,6bS,14aR,14bR)-4,4,6a,6b,11,11,14b-heptamethyl-1,2,3,4,4a,5,6,6a,6b,7,8,9,10,11,12,14,14a,14b-octadecahydropicen-3-ol	present	NPASS
(3S,4aR,6aR,6bS,8aS,12aS,14aR,14bR)-8a-(hydroxymethyl)-4,4,6a,6b,11,11,14b-heptamethyl-1,2,3,4a,5,6,9,10,12,12a,14,14a-dodecahydropicen-3-ol	present	NPASS
Aegicerin	present	NPASS
Isorhamnetin	present	NPASS
Primulagenin A	present	NPASS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arctotis revoluta has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences2

eDNA detections3

The DNA barcodea real sequence read deposited for this species

ITSEU846378.1 ↗642 bp

ACGT

TCGAACCCTGCAAAGCAGAACGACCCGTGAACATGTATTGACAACCGGGCGCCATGGGGACGGGCTCATACCCCTTACCTGTGGTGCCCT …

Arctotis revoluta isolate RM1071 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Arctotis revoluta carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 181×CCDB · Oberlander2016

CCDB · Oberlander2016 — Carr, King, Powell & Robinson, 1999

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type79 records

Wild obs. + sensor10

Museum / vouchered69

Range

Area of Occupancy AOO212 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 7≤1 km 2≤10 km 1

10 georeferenced

Open the mapobservation + sensor10

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 69 records without

Open the institutions mapphysical evidence69

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cape Town, ZA	51
Pretoria, ZA	12
Stockholm, SE	3
MSB-3054location not on record	1
Kew, GB	1
Dublin, IE	1

6 institutions · 69 of 69 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Arctotis revoluta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)